ID: 979290056

View in Genome Browser
Species Human (GRCh38)
Location 4:118969528-118969550
Sequence GAAGGCCAACTTTTCATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979290048_979290056 30 Left 979290048 4:118969475-118969497 CCCTCTGCTGCTCTGAGGAGGTG 0: 1
1: 0
2: 2
3: 43
4: 312
Right 979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG 0: 1
1: 0
2: 2
3: 22
4: 161
979290049_979290056 29 Left 979290049 4:118969476-118969498 CCTCTGCTGCTCTGAGGAGGTGT 0: 1
1: 0
2: 5
3: 28
4: 210
Right 979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG 0: 1
1: 0
2: 2
3: 22
4: 161
979290052_979290056 0 Left 979290052 4:118969505-118969527 CCAGTCTTTTATATCCCATTGGA 0: 1
1: 0
2: 1
3: 19
4: 175
Right 979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG 0: 1
1: 0
2: 2
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979290056 Original CRISPR GAAGGCCAACTTTTCATTTA TGG Intronic
901751354 1:11412104-11412126 GATGGCCTACTTTCCAATTATGG - Intergenic
906465064 1:46071217-46071239 GAAGGCAAAATTTTTTTTTAGGG - Intronic
907608415 1:55842919-55842941 GAAGGCCAATCTTTCATTAGGGG - Intergenic
908821951 1:68096947-68096969 GAAGCCCAACTTTTCTTTGTGGG + Intergenic
911399439 1:97356760-97356782 AAAGGACATCTTTTCATTAAAGG - Intronic
911930258 1:103893896-103893918 GATTTCCAACTTTTCCTTTAGGG + Intergenic
912073537 1:105843252-105843274 GAAGGCCAACATTGCATTTATGG - Intergenic
915187483 1:154119271-154119293 GAGGGCCAACTTTTTGTGTAAGG + Intronic
915553618 1:156648987-156649009 GAAGTCCAGCTTGTCATCTAGGG + Intronic
916728625 1:167546212-167546234 GAAGGCCAGGTTTTCATCTCAGG + Exonic
917291813 1:173478045-173478067 GAAGGCCAACGTATCATCTGAGG + Intronic
922356915 1:224785148-224785170 GTAGGCAAACTTTTCCTTAAAGG - Intergenic
923670662 1:236037900-236037922 GAAGGCCCATTTTTCAAATATGG - Intronic
923731058 1:236550413-236550435 TAAAGCCTACTTTTCATTTTGGG - Exonic
1065005391 10:21375129-21375151 GAAGGCCAACATTTCTTATGTGG + Intergenic
1067416173 10:46105114-46105136 GAAGCAAAACTTTTCTTTTATGG - Intergenic
1067436316 10:46281606-46281628 GAAGCAAAACTTTTCTTTTATGG - Intergenic
1073772181 10:106746889-106746911 GAAGGCCAACTGATCATAGAAGG + Intronic
1075133539 10:119762030-119762052 GAGAGCCAACTTTTCATATACGG - Intronic
1075281438 10:121142251-121142273 GAAGGGTATCTTTTTATTTAAGG + Intergenic
1076148068 10:128140974-128140996 GAAAGACAAGTTTTCATTAATGG + Intergenic
1079515116 11:21258187-21258209 GAAGGCCAAGATTTCATTTGAGG + Intronic
1081970497 11:47195061-47195083 GAAGGTCAAGTTCTCATGTAAGG - Intergenic
1083159502 11:60846211-60846233 GAAGCCCAGCTTTACAGTTATGG + Intronic
1088277805 11:108107214-108107236 GAAAGCTAACATTTCATTTTTGG - Exonic
1088781684 11:113141083-113141105 GTAAGCCAGCTGTTCATTTAGGG + Intronic
1089923538 11:122232953-122232975 GAACTTCAACTTTTTATTTAAGG + Intergenic
1090584635 11:128197709-128197731 GAAGGCTAACTTATTTTTTAAGG - Intergenic
1092228306 12:6763338-6763360 GAAGGCCTAGTTATCATTCAAGG - Intronic
1094288190 12:28817446-28817468 ACAGGCCAACTTTTCATCTCTGG - Intergenic
1095105541 12:38229372-38229394 GCAGGCCAACATTTAATTTCAGG - Intergenic
1096548763 12:52358851-52358873 ATAGGCCAACTTTCAATTTAGGG - Intergenic
1099380667 12:81948373-81948395 GCAGTCCAACTTTTTATTTCAGG - Intergenic
1100168112 12:91941119-91941141 AAAGGCCAAGTTTCTATTTATGG + Intergenic
1102976372 12:117209756-117209778 GAAGGGCAGCTTTTCTTTTGGGG + Exonic
1104377792 12:128280145-128280167 GAAGGCCACCATTTTATTAAAGG + Intronic
1107107375 13:36659656-36659678 GAAGGGAAACTTCTCAGTTATGG + Intergenic
1107390799 13:39961789-39961811 GAAGGGAAAGTTTACATTTATGG + Intergenic
1107762409 13:43694666-43694688 GTAGGCAAAATTTTAATTTATGG + Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108779671 13:53813826-53813848 GATGACCAAATTTTCATTTCAGG + Intergenic
1110619332 13:77577774-77577796 GATGGCCAATATTTCATTTTAGG - Intronic
1111013331 13:82341754-82341776 GAAGACCTACATTTGATTTAAGG - Intergenic
1113678854 13:112227950-112227972 AAAGGACATCTCTTCATTTACGG + Intergenic
1114644995 14:24250632-24250654 GAAGGCCTACTTTTCCTCCAAGG + Intronic
1115929585 14:38476503-38476525 GCAGGCCAACTGTCCATTAAGGG - Intergenic
1116320500 14:43455724-43455746 GCAGGCCAACTTTTAAATTCAGG + Intergenic
1116611410 14:47077857-47077879 GAAGTACAACTTCTCTTTTATGG + Intronic
1117524630 14:56585678-56585700 AAAGGGCTACTTTTCAATTAAGG + Intronic
1117549006 14:56815688-56815710 GAATGCAAACTTTCCATTTTCGG + Intergenic
1117558794 14:56913957-56913979 GAAAGCCAATCTTTTATTTATGG - Intergenic
1118706493 14:68485106-68485128 GAAGGCCAGCTTTTCCTAGAGGG + Intronic
1120465813 14:84855817-84855839 GAACTTCAACATTTCATTTAGGG - Intergenic
1120689862 14:87580537-87580559 GAAGGTCAACTGTTCATATAAGG - Intergenic
1121320734 14:92990236-92990258 GAAGGCCTAGTTCTCTTTTAAGG - Intronic
1123818560 15:24003547-24003569 GAGGGCCATCTTTTGATTCATGG + Intergenic
1130917097 15:88313714-88313736 GAAGGCCGACTTTTCTCTTCTGG - Intergenic
1135737142 16:24940780-24940802 GAAGGCTGACTTTTCACTTAAGG + Intronic
1136273637 16:29164856-29164878 GAATGCCAACTCTGCATTTTTGG + Intergenic
1137470658 16:48754050-48754072 GAATGACATCTTGTCATTTATGG + Intergenic
1139115838 16:63951119-63951141 CTTGGGCAACTTTTCATTTAAGG + Intergenic
1141454773 16:84133753-84133775 GGGGCCCAACTTTTCATTTGAGG - Intronic
1142077176 16:88126601-88126623 GAATGCCAACTCTGCATTTTTGG + Intergenic
1144170588 17:12656329-12656351 GAAGGGGAGCTTTTCATTTTAGG - Intergenic
1144454337 17:15406624-15406646 AAAGGCCAACTTTGCTTTTAGGG - Intergenic
1145053115 17:19679540-19679562 GAAGGCCAACTTTTAACTTGTGG - Intronic
1149198741 17:54157099-54157121 CAAGCCCATCTTTTCCTTTAGGG - Intergenic
1149294336 17:55248209-55248231 CAAGGCAATCTTTTCTTTTAAGG - Intergenic
1149631001 17:58123203-58123225 GAAATGCAATTTTTCATTTAGGG - Intergenic
1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG + Intronic
1153049563 18:888852-888874 TAAGCCCAAATTTTTATTTAAGG + Intergenic
1153688960 18:7572597-7572619 CAAGGCTTAGTTTTCATTTAGGG + Intronic
1158480570 18:57818064-57818086 GAAGGCTAACATTTCACTTTTGG - Intergenic
1159386305 18:67729524-67729546 GATGGCCAACTTTTCAATCATGG - Intergenic
1165782813 19:38443746-38443768 GAAGGCCAGCTTGTCAGTCATGG - Exonic
1168447107 19:56428913-56428935 GACTGCCAACTTTTCATTCTAGG - Intronic
926750812 2:16197297-16197319 GAGGGCCAAATTATCATTTTTGG + Intergenic
931314856 2:61119358-61119380 GAAGTCCAATTTTTCATTTATGG - Intronic
932390546 2:71386794-71386816 GAATGCCATTTTTTCATTTAAGG - Intronic
933894891 2:86801709-86801731 CAAAGCCAACTATTTATTTATGG + Intronic
941306988 2:163882212-163882234 GAAGAGCAACTATGCATTTAGGG - Intergenic
941364893 2:164598208-164598230 GAATGCCAACTTGTTATCTACGG - Intronic
941473295 2:165917234-165917256 GTAGGTCAAGTTTTAATTTAAGG - Intronic
942294348 2:174503311-174503333 TAAGGCCAACTGTTCAAATAAGG - Intergenic
943424142 2:187708350-187708372 GAAGGCCAAATTTTGGTTTTGGG - Intergenic
943433325 2:187831565-187831587 GAAGGACACAATTTCATTTATGG - Intergenic
946173976 2:217911543-217911565 GAATTACAACTATTCATTTAGGG + Intronic
946270725 2:218591095-218591117 AAAGTCCCATTTTTCATTTAAGG + Intronic
947151597 2:227121980-227122002 GAAGGACAACATTTCTTTTTTGG + Intronic
948353371 2:237358977-237358999 GAATATCAACATTTCATTTAGGG - Intronic
1170073656 20:12395870-12395892 TTAGGACTACTTTTCATTTAGGG + Intergenic
1171881315 20:30619363-30619385 GAAGGCAAACTTCTCATGAATGG - Intergenic
1172262647 20:33581761-33581783 TAAGGCTAACTTTTCATTCTGGG - Intronic
1173240987 20:41297070-41297092 GAATGCCAACTTTTCCTGTTGGG + Intronic
1175595682 20:60230656-60230678 GAAGGACAACCACTCATTTAGGG - Intergenic
1177166974 21:17613381-17613403 GAAGGGGAACTTGGCATTTATGG + Intergenic
1178032534 21:28544285-28544307 GAAGGCCATTTTCTGATTTAGGG + Intergenic
1179063733 21:38004623-38004645 GAAGGCAAACTTTTCTTTAAAGG + Intronic
949634926 3:5972281-5972303 GAAGGCAGACATCTCATTTAAGG - Intergenic
950897226 3:16464141-16464163 GAAAGCCAACTGTGCATTTCTGG + Intronic
951626234 3:24666836-24666858 GAAGGGCAAAATTTAATTTAAGG - Intergenic
952471318 3:33655568-33655590 GAAGGCTAACTTTTCTTGTAGGG - Intronic
953819676 3:46194879-46194901 CAAGGTCACCTTTTCACTTAAGG + Intronic
956521702 3:70111036-70111058 GAAGGCCAAGTTATCAATAAAGG + Intergenic
957550710 3:81699875-81699897 GAAGGCCAAATCATCTTTTATGG - Intronic
957758710 3:84526248-84526270 AAAGGCCAGCTTTGCCTTTAGGG - Intergenic
958973969 3:100644881-100644903 TAGGGTTAACTTTTCATTTAGGG + Intronic
959324245 3:104916155-104916177 AAAGGTCAACTCTTCATTTAGGG + Intergenic
960514216 3:118585412-118585434 GAAAGCCTACTTCTCATTTCTGG - Intergenic
960921307 3:122749433-122749455 GAAGGAATTCTTTTCATTTATGG - Intronic
961589715 3:127968580-127968602 GTAAGCCAACTTTTCATTTCTGG - Intronic
962079916 3:132127448-132127470 TAAGGCCAAGTTTTCTTCTAGGG - Intronic
962347933 3:134634755-134634777 GAGGGCCAACTTTTCCTACATGG + Intronic
964247413 3:154669738-154669760 GAATGTAAAGTTTTCATTTAGGG - Intergenic
964359001 3:155874688-155874710 GTGGGCCAACTTGTCACTTAAGG + Intronic
965348515 3:167583044-167583066 TAATGCCAACATTTCATTTAAGG + Intronic
965780786 3:172283817-172283839 GTATGTCAACTTTTGATTTATGG + Intronic
966815396 3:183885860-183885882 GAAAGCCCGCTTTTCATTTCAGG - Intergenic
971853891 4:32019268-32019290 GAAGGCAAACTTATCAGTTTAGG + Intergenic
972494140 4:39617213-39617235 TAAGGCCAAGTTTTTATCTATGG + Intronic
973228646 4:47816740-47816762 GAAGGACAATTTTTCACTGATGG + Intronic
975339097 4:73217406-73217428 GAAGTCCAATTTTTCATGTAAGG - Intronic
975870296 4:78773049-78773071 GAACTTCACCTTTTCATTTAAGG - Intergenic
975961055 4:79905854-79905876 GAAGGCGAACATTTCATGTTTGG - Intronic
976928265 4:90529819-90529841 GAGGGCCCACCTTTCTTTTAGGG + Intronic
978036032 4:103996132-103996154 CATGGCCAAGTTTTCATTAAAGG - Intergenic
978413608 4:108452188-108452210 AAAGGTCAACATTTCATTTCTGG + Intergenic
978974399 4:114851143-114851165 GAAAGACAAGTTTGCATTTAAGG + Intronic
979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG + Intronic
979752488 4:124296017-124296039 GAAGTCCAATTTTTCATTTTTGG + Intergenic
980930850 4:139181273-139181295 AAAGGCTAAATTTTCATTTATGG - Intergenic
984907170 4:184639274-184639296 GAAGCCCAGCTTCTCATTTAGGG + Intronic
987782370 5:22455742-22455764 TGAGGCCAACATTTCATTTTTGG + Intronic
988450705 5:31340080-31340102 GTAGGCTACCTTTCCATTTATGG + Intergenic
989540248 5:42609906-42609928 TAAGGCCAATTTATCCTTTAAGG - Intronic
991227602 5:64291350-64291372 GAAGGCCAACATTCCAATTCAGG - Intronic
993809336 5:92456448-92456470 GAAGTCTATCGTTTCATTTATGG + Intergenic
996053044 5:118953440-118953462 GAAGGTCAAATTTTCATGCAGGG - Intronic
996482672 5:123992522-123992544 GCAGGTCAACTTTTCATTCAAGG - Intergenic
996614167 5:125419900-125419922 GAAGATCAAATTATCATTTAGGG - Intergenic
996890165 5:128409456-128409478 GAAAGCAGACTTTTCATTAATGG - Intronic
998851230 5:146352745-146352767 GAAGGCTTACTTTTGTTTTATGG + Intergenic
1001286878 5:170430275-170430297 GAAGGCCCCCATTCCATTTATGG + Intronic
1002497006 5:179622730-179622752 GAACACCAGCTTTTCTTTTATGG - Intronic
1003259346 6:4502762-4502784 CCAGGCCAACTGTGCATTTAAGG + Intergenic
1007146254 6:39636072-39636094 GGAGTCCAGCTTTTTATTTATGG - Intronic
1009724300 6:67517033-67517055 TTAGGCCAACTTTTCATTTCTGG - Intergenic
1010347354 6:74827040-74827062 GTAGTCCAACTCTTCATTTTGGG + Intergenic
1011323421 6:86122202-86122224 GAAGACCTACTTGTCAGTTATGG - Intergenic
1012803961 6:103870982-103871004 TAAGGCCAACTTAATATTTAAGG + Intergenic
1013879714 6:114881983-114882005 GAATGCAGACTTTTTATTTAGGG - Intergenic
1014514733 6:122365158-122365180 ACAGGCCAACTCTTCATTTCTGG - Intergenic
1014607737 6:123498779-123498801 GACTTCAAACTTTTCATTTAAGG - Intronic
1018498583 6:164377882-164377904 GAAAGCAAACTTTTCATGTATGG - Intergenic
1019018128 6:168895248-168895270 GAAGGGCAACTTTTCACTTCAGG - Intergenic
1020910057 7:14117926-14117948 GAATGACAATTTTTCAGTTACGG - Intergenic
1021027821 7:15689827-15689849 TAATGCCAACATTTCATGTAAGG + Intergenic
1021404098 7:20244217-20244239 AAAGGATAACTTTTCATTGAGGG + Intergenic
1022188980 7:27998397-27998419 AAAGACCAACTTTTAATTCATGG + Intronic
1023075121 7:36474262-36474284 ACAGGCCAACTTTTCATCTCTGG + Intergenic
1024289475 7:47791664-47791686 GAAGTTCAACTTTTCATAAACGG + Intronic
1024927875 7:54636900-54636922 GCGGGCCACCTTTTCATATAGGG + Intergenic
1030104778 7:105977917-105977939 GGATGCTAACATTTCATTTACGG + Intronic
1032336142 7:131026732-131026754 AAAGGCCAACATTTAATTAAAGG - Intergenic
1033641782 7:143268648-143268670 GAAGGCTTCCTTTTCTTTTATGG - Intronic
1036624952 8:10462716-10462738 GAAGGCAAATTTTTCATTATTGG - Intergenic
1040926768 8:52692950-52692972 GAAGATCACCTTTTCATTTATGG - Intronic
1041137206 8:54773026-54773048 GGAGCCCAACTTTTCACTAAGGG + Intergenic
1041438753 8:57870838-57870860 GAAGACCAACTTGGCATCTATGG + Intergenic
1041735141 8:61103013-61103035 GAAGGCTTTCATTTCATTTATGG + Intronic
1042647110 8:70998978-70999000 GAGGACCAACTTTTCATCTGCGG - Intergenic
1046198224 8:110890588-110890610 GCAAGCCAACTTTTCATCTCTGG + Intergenic
1051672434 9:19524696-19524718 GAAGCCTTACTTTTCATTGATGG - Intronic
1057326726 9:94071499-94071521 GAAGTCCAATTATTCTTTTATGG + Intronic
1059303163 9:113331791-113331813 GAAGGCCAACTATTCAGGGAAGG + Intronic
1060361295 9:122959974-122959996 TAAGGCCAACTTTTCTCTGAAGG - Intronic
1060492291 9:124093754-124093776 GAAGGCCAACCTTTCACATTTGG + Intergenic
1061109494 9:128558382-128558404 TAAGGACAACTTCCCATTTAAGG - Intronic
1188069422 X:25700732-25700754 GAAGGCGAATTTTTCATGTTTGG + Intergenic
1188323328 X:28767510-28767532 GAATGACAACTTTTTAATTAGGG + Intronic
1188640758 X:32500840-32500862 GAATGCCAAATTTGCAATTAAGG + Intronic
1188736672 X:33726254-33726276 GAAACCCAACTTTTCCTTTTAGG - Intergenic
1189376072 X:40467153-40467175 GAAGGCCCCCATTTCTTTTAAGG - Intergenic
1194130007 X:90069948-90069970 CAAAGCCAACTTTACACTTATGG - Intergenic
1196656482 X:118223260-118223282 GAGGACCAACTTTTCCTATATGG - Intergenic
1197951915 X:131907510-131907532 GAAGTGCAATTTTCCATTTATGG + Intergenic