ID: 979292250

View in Genome Browser
Species Human (GRCh38)
Location 4:118991009-118991031
Sequence CCTTCCAAGTCAACTCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979292243_979292250 7 Left 979292243 4:118990979-118991001 CCACATGCAGCCTGAACTGGGCC 0: 1
1: 0
2: 2
3: 14
4: 217
Right 979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 139
979292245_979292250 -3 Left 979292245 4:118990989-118991011 CCTGAACTGGGCCAACAGGCCCT 0: 1
1: 0
2: 1
3: 8
4: 142
Right 979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 139
979292240_979292250 23 Left 979292240 4:118990963-118990985 CCAGGTGAAAGCAGCTCCACATG 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979292250 Original CRISPR CCTTCCAAGTCAACTCCTTT GGG Intronic
907321374 1:53604699-53604721 CCTGCCCAGTCAACTCCTGAGGG - Intronic
908203747 1:61823841-61823863 CCTTCCCATTATACTCCTTTAGG - Intronic
908440568 1:64149722-64149744 CCTTCCAAGTCAAATATCTTGGG + Intronic
910540834 1:88355174-88355196 CCTTTGATGTCAGCTCCTTTGGG + Intergenic
911904701 1:103552137-103552159 CCTACCAAATCAACTCTTTCAGG - Intronic
913017220 1:114751127-114751149 CTTACTAAGTCATCTCCTTTAGG - Intronic
913416929 1:118619116-118619138 CCTTCCAAGTCCACTGGCTTTGG + Intergenic
914721626 1:150294005-150294027 ACTCCCAACTCAACCCCTTTTGG + Exonic
915068445 1:153245510-153245532 CCCTCCATGTCTACTCCATTTGG + Intergenic
915520546 1:156439912-156439934 CCCTCCACTTCAACTCCTCTGGG + Intergenic
917671877 1:177280936-177280958 CCATCTACGTCAACCCCTTTGGG + Exonic
918093182 1:181314810-181314832 CATTCCAACTAAACACCTTTGGG - Intergenic
920608883 1:207418060-207418082 CCCTCCAAGGTAACTTCTTTGGG - Intergenic
921849341 1:219918260-219918282 TCTTCCATGTTGACTCCTTTTGG + Exonic
1063458705 10:6202499-6202521 CCTACCAATGCAGCTCCTTTAGG - Intronic
1063695279 10:8329158-8329180 CTGTCCAAGGCTACTCCTTTAGG + Intergenic
1065865741 10:29913775-29913797 GCTTCCAAGGCCAGTCCTTTGGG - Intergenic
1067692096 10:48508526-48508548 CCAGCAAAGTCACCTCCTTTTGG + Intronic
1067919180 10:50435860-50435882 CCTTCCAAGTCACCCTCTTTGGG + Intronic
1068092036 10:52443835-52443857 ACTTCCAAGTCAACTGATGTTGG - Intergenic
1077242566 11:1518262-1518284 CCTTCCAAGTGAGCTCTTTGAGG - Intergenic
1078788353 11:14519281-14519303 CCCTCCATATCAACCCCTTTAGG + Intronic
1084529737 11:69719795-69719817 CCATCCCAGTCCACTCCTGTGGG + Intergenic
1089490534 11:118880700-118880722 CCTTCAAAATGAAATCCTTTAGG + Intergenic
1089793445 11:120961067-120961089 TCTTCCAAGTAAACCCCATTTGG + Exonic
1091587595 12:1825067-1825089 CCTTGCAAGACAACACCTGTGGG + Intronic
1095052752 12:37568711-37568733 CTCTCCAAATCCACTCCTTTTGG - Intergenic
1096094605 12:48925906-48925928 TCTTCCAAGTCGTCTCCTTGTGG + Intronic
1097700761 12:62818014-62818036 CATTCCAAGTCTACTTCCTTAGG - Intronic
1100701903 12:97157953-97157975 GCATCAAAGTCAACACCTTTTGG + Intergenic
1101791510 12:107931946-107931968 ACTCCCATGTCAACTGCTTTTGG - Intergenic
1102780247 12:115558032-115558054 CCTTCCATGTGAATGCCTTTGGG + Intergenic
1104375532 12:128263046-128263068 CGTTCCATGTCAACTCCATGAGG - Intergenic
1106326666 13:28697853-28697875 CCTGCCAAGTCAAATCACTTGGG - Intergenic
1107305617 13:39015058-39015080 CCTTACCTGGCAACTCCTTTAGG + Intronic
1111060911 13:83017496-83017518 TCTTCCAAGCCAACTGCTTCAGG + Intergenic
1115348554 14:32368515-32368537 CCTTTAAAGTCACTTCCTTTTGG - Intronic
1119705070 14:76778188-76778210 CATCCCAAGTCACCTCCCTTGGG - Intronic
1119822000 14:77624716-77624738 CTTTCCCTGTCAACTCTTTTGGG - Intergenic
1125496229 15:40196986-40197008 CCTTCCATGAAAACTCCTTGGGG + Intronic
1126833397 15:52633935-52633957 CCTTCCATTTCACCTTCTTTGGG - Intronic
1127303883 15:57683296-57683318 CCTTCAAATTCAGTTCCTTTTGG - Intronic
1128739766 15:70075668-70075690 CCTTCCAAGGGACCTCCATTTGG - Intronic
1129712572 15:77827998-77828020 CCTTCCAACTCTTCTCCTTCAGG + Intergenic
1131457256 15:92591378-92591400 CCTTCTAATTAAACTCCTTGTGG + Intergenic
1134056333 16:11172458-11172480 CATTCCAAGTGAACTACCTTGGG + Intronic
1135720600 16:24814358-24814380 CCTTCCAAATTTACTCCTTCTGG + Intronic
1136613639 16:31382124-31382146 AATTGCAAGTCAAGTCCTTTGGG - Intronic
1136990391 16:35148169-35148191 CCTTCCTAGGCACCTCCCTTTGG + Intergenic
1139083065 16:63549414-63549436 GCTACCATGTCAACTCTTTTTGG - Intergenic
1139884349 16:70197957-70197979 CCTTCCAGGTCAGCCACTTTGGG + Intergenic
1140368169 16:74397539-74397561 CCTTCCAGGTCAGCCACTTTGGG - Intergenic
1141101608 16:81201537-81201559 ACTTCCGAGTCACTTCCTTTTGG - Intergenic
1145704431 17:26858975-26858997 CCTTTCAAGACCATTCCTTTTGG - Intergenic
1145755662 17:27388456-27388478 CCTTCCAAAAAAACTCCTTGAGG - Intergenic
1145935139 17:28710963-28710985 CCTTCCCACCCTACTCCTTTCGG - Intronic
1148737146 17:49871250-49871272 CCTTCGAAGTCTTCTCCTTCTGG + Intergenic
1150912929 17:69408048-69408070 CCTTCCTAACCTACTCCTTTGGG - Intergenic
1150969036 17:70005718-70005740 GCTCCCAAGTGAACTCCCTTAGG - Intergenic
1153261143 18:3225605-3225627 TCTTCCTAGACTACTCCTTTTGG + Intergenic
1153866868 18:9278257-9278279 CCTTCCAAGGCTACTCCCATAGG - Intronic
1156571845 18:38264496-38264518 CCCTCCAAGGCCACTCCTATTGG - Intergenic
1157750331 18:50172833-50172855 TCTGCCAAGTCACCTCCTCTGGG - Intronic
1159289620 18:66398829-66398851 CCTTCCAAGTCTAGGCCTTTTGG + Intergenic
1159599867 18:70418881-70418903 CCTTCACAGTCTCCTCCTTTGGG - Intergenic
1160847902 19:1174351-1174373 CCTTCCAAGCCAATCCCTTGAGG + Intergenic
1167428510 19:49441673-49441695 CCTTCCAAGACCACGCCTGTGGG + Intronic
928341296 2:30445547-30445569 CCTTCCACGTCAACTGCTAAAGG - Intergenic
928859595 2:35841276-35841298 CCTTCTAACTGAACTCCATTTGG + Intergenic
932624942 2:73290063-73290085 CCTTCCAAGTGAACTCTTCATGG - Intergenic
933097743 2:78209117-78209139 CCTTCCAACTCTTCTCCCTTTGG - Intergenic
935116077 2:100137644-100137666 TCTTCCATGCCAACTCCCTTAGG - Intronic
940063482 2:149599324-149599346 CCTTCCATGACAACTTCTCTAGG + Intergenic
941947038 2:171110712-171110734 CCTTTGTAGTCAACTCCTCTAGG - Intronic
942931081 2:181493342-181493364 CCTTGCAAGTCATCTTCTTGTGG - Exonic
946979415 2:225191849-225191871 CCTGGCCAGTCCACTCCTTTGGG - Intergenic
947742200 2:232489757-232489779 AATTCCAAGTCAACTCCTGTAGG - Intergenic
947824701 2:233097775-233097797 CCTTCCAATGCAACTCATTTAGG + Intronic
1170507360 20:17041206-17041228 CCTGGCACGTCAACTCTTTTGGG - Intergenic
1172060681 20:32185243-32185265 CCACCCAACTCAAATCCTTTGGG + Intergenic
1173555592 20:43963296-43963318 CCATCCAAGCCAACTCTTGTTGG + Intronic
1174798008 20:53538752-53538774 CCTTCCAAATCACTTCCTTGGGG - Intergenic
1177039707 21:16093517-16093539 CCTTCTAACTCTTCTCCTTTTGG + Intergenic
1182552059 22:31105917-31105939 CCTTCAAACTCACCTCCTTTAGG + Exonic
1185101919 22:48845184-48845206 CCTTCCTAGCCAACCCCTGTGGG + Intronic
950061405 3:10074523-10074545 CCTTCCCTGTGAACTCCTATGGG - Exonic
950906624 3:16544757-16544779 CCTTCCAAGTCAATTGCTTCTGG + Intergenic
952281625 3:31928848-31928870 CTTTCCCTGTCAACACCTTTTGG - Intronic
953621372 3:44535664-44535686 CCTCCCAGGCCAACCCCTTTAGG + Intergenic
953793843 3:45967947-45967969 CCTTCCCAGACAACTCCTCCTGG + Exonic
954050970 3:47977101-47977123 CATTAGAAGTCAACTCATTTGGG + Intronic
954902379 3:54030957-54030979 CCTGACAAGTCACCTCCTTATGG + Intergenic
955353437 3:58210811-58210833 CCTTCAACGTCAGGTCCTTTGGG - Exonic
959496340 3:107056998-107057020 CCTTCCAACTCACCTTCTCTAGG + Intergenic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
961700047 3:128736814-128736836 CCTTCCAAGTCCACACATGTAGG - Intronic
963064259 3:141251199-141251221 CCTTCCAGCTCAAATCATTTTGG - Intronic
963665162 3:148175363-148175385 ATTTCCAAGTCAATTCATTTTGG - Intergenic
966069537 3:175858611-175858633 CATTCCAATTCCACTCTTTTGGG - Intergenic
970678984 4:18485546-18485568 CCTTCAAAGTGAACACCTTCAGG + Intergenic
972919854 4:43925247-43925269 CATTCAGAGTCAACTCGTTTGGG + Intergenic
974054574 4:56972565-56972587 CCTTCCAAGGTAACTCATTTGGG - Intronic
976802266 4:89006270-89006292 CCTTCCAAGGCAACTCTTACAGG + Intronic
977824941 4:101519964-101519986 ACTATCAAGTCAACTGCTTTTGG - Intronic
978003598 4:103588748-103588770 TCTTCAAAGGCAACTCCTTAGGG - Exonic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
981067536 4:140500473-140500495 CATTTCAAGTCCACTCTTTTAGG - Intergenic
982000092 4:151014763-151014785 CTTTCCACATCAACTGCTTTGGG - Exonic
982412140 4:155090374-155090396 CCCTTCAATTCAACTCATTTGGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985987203 5:3525864-3525886 TCTTCCAATTCCACTCCTATTGG + Intergenic
989769222 5:45122391-45122413 CCTTCCAAGGCAACAACTATGGG - Intergenic
989916213 5:49732376-49732398 CATTCCCAGTAAACTTCTTTAGG + Intergenic
989934973 5:50010225-50010247 CATTCCCAGTAAACTTCTTTAGG + Intergenic
994539327 5:101075066-101075088 TCTTCCATGGCAACTACTTTAGG - Intergenic
996230561 5:121058600-121058622 CCTTCCTATTCATGTCCTTTAGG - Intergenic
996532667 5:124542663-124542685 CCTTACAAGTCAGTTCCTCTGGG + Intergenic
998127838 5:139636177-139636199 CCTCCCAAATAAACTCCTTAAGG - Intergenic
1002463853 5:179393923-179393945 TCTTCCAAGCAAGCTCCTTTTGG + Intergenic
1003204818 6:3998641-3998663 CTTTCCAAGTTGTCTCCTTTTGG - Intergenic
1004518910 6:16344105-16344127 CCTTCCATGTCACCTCCTTAAGG + Intronic
1005000046 6:21231259-21231281 CCTTCAAATTAAACTGCTTTTGG + Exonic
1007341228 6:41192607-41192629 CCTTCCAGGTCATCCCCTTAGGG + Intronic
1008326080 6:50183849-50183871 CCTGCAAAGTAAACTCCTTTTGG - Intergenic
1012116980 6:95312853-95312875 CTTTCCAAGTCAGCTCCTACTGG + Intergenic
1012758524 6:103264370-103264392 CCATCCCAGTCAACTCCTTGTGG - Intergenic
1013210451 6:107982430-107982452 CCTCCTAAGTCAACTCCATGTGG - Intergenic
1015986650 6:138891296-138891318 CCTGCAAAGTCATCTCTTTTGGG + Intronic
1016810499 6:148256687-148256709 TCTTTGCAGTCAACTCCTTTTGG - Intergenic
1023299887 7:38758852-38758874 CCCTCCAAAGCCACTCCTTTTGG - Intronic
1023814800 7:43941466-43941488 CCTTCCAGGTCACCACCATTTGG - Intronic
1031524459 7:122807540-122807562 CCTTCCAAGTTTGTTCCTTTTGG + Intronic
1032915526 7:136484714-136484736 CCTATCAAATCAACTTCTTTAGG + Intergenic
1034860918 7:154594068-154594090 CCTTCCAAGGCAATTGATTTTGG + Intronic
1038192470 8:25335854-25335876 TCTTTTAAGTCAACTCCTGTAGG + Intronic
1046817052 8:118596591-118596613 CCTGGCAACTCAACTACTTTAGG + Intronic
1047522859 8:125608832-125608854 CCTTTCATGTAAACTCATTTAGG + Intergenic
1047745003 8:127838284-127838306 CCTTGCAAGACAAGTACTTTAGG - Intergenic
1050411826 9:5373996-5374018 CCTTCTCAGACACCTCCTTTTGG + Intronic
1058005826 9:99912858-99912880 CCTTGCTATTCCACTCCTTTGGG + Intronic
1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG + Intergenic
1060436753 9:123599814-123599836 CCTTCCAAATCAATTATTTTAGG + Intronic
1062323818 9:136003298-136003320 CCTTCCAAGCCAAGCCCTTGAGG - Intergenic
1062388814 9:136326060-136326082 CCTTCCGGGCCACCTCCTTTGGG - Intergenic
1191727039 X:64292482-64292504 CCTTCCAACTCATCTCCTGCAGG - Intronic
1195855527 X:109328190-109328212 CCTTCCTAGTCAATTTTTTTTGG + Intergenic
1198054768 X:132982977-132982999 CCTTCCAAACCAACTACTGTGGG - Intergenic
1202272981 Y:23088305-23088327 TCTTCCAAGTCAAATGCTTCTGG + Intergenic
1202293045 Y:23332377-23332399 TCTTCCAAGTCAAATGCTTCTGG - Intergenic
1202425978 Y:24722049-24722071 TCTTCCAAGTCAAATGCTTCTGG + Intergenic
1202444811 Y:24948037-24948059 TCTTCCAAGTCAAATGCTTCTGG - Intergenic