ID: 979293459

View in Genome Browser
Species Human (GRCh38)
Location 4:119003651-119003673
Sequence ACATAGAGACTATACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979293459_979293464 14 Left 979293459 4:119003651-119003673 CCCTCCCAGTATAGTCTCTATGT 0: 1
1: 0
2: 1
3: 10
4: 113
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979293459 Original CRISPR ACATAGAGACTATACTGGGA GGG (reversed) Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG + Intergenic
913046097 1:115074651-115074673 ACTTAGAAAATATACTGAGAAGG - Intronic
917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG + Intronic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
924290819 1:242534619-242534641 ACATCAGGACTATACTGGAAAGG - Intergenic
924736668 1:246763277-246763299 ACCCAGAGACTATGCTGGGTCGG + Intronic
1063137343 10:3229209-3229231 AAATAGAGGCTAGACTGGGAAGG - Intergenic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1066008581 10:31171197-31171219 TGATAGAGACTATATTGGGTAGG + Intergenic
1067359255 10:45562143-45562165 ACATAAAGAATAGACTGAGATGG + Intronic
1071778721 10:88818634-88818656 CCATAGAAACAATACTGGAAGGG + Intronic
1072759438 10:98043809-98043831 AAATAGAGACTATGCTAGCAGGG - Intergenic
1073415490 10:103378136-103378158 ACATTGAAAATATTCTGGGATGG + Intronic
1073818763 10:107236328-107236350 AGATAGAGACAATACTGAGTAGG + Intergenic
1076298908 10:129409693-129409715 CCATAGATAGTATGCTGGGAAGG - Intergenic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1082640552 11:55654777-55654799 ACAGAGTGTCTATACTGGCAAGG - Intergenic
1086614223 11:88795442-88795464 ACAAAGATACTCTACTAGGATGG + Intronic
1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG + Intronic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1096457342 12:51798618-51798640 ACAAAGTGACTATAGTGGCAGGG - Intronic
1101366919 12:104081053-104081075 ACATAAAGCCTACACTGGGCAGG - Intronic
1107062516 13:36174975-36174997 AAATGGAGACTATATAGGGAGGG - Intronic
1108983021 13:56544181-56544203 GTATAGAGATTTTACTGGGATGG + Intergenic
1109793179 13:67276434-67276456 ACATAGAGACTATTCTGATCTGG + Intergenic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1110421658 13:75316748-75316770 ACTTGGAAACTACACTGGGATGG + Intronic
1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG + Intergenic
1119432153 14:74575489-74575511 TCACAGAGACTATAATGTGAAGG + Intronic
1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG + Intergenic
1120211989 14:81642280-81642302 ACACAGAGAGTATACTGAAATGG - Intergenic
1120292852 14:82598735-82598757 ACAGAGGGATTATAATGGGAAGG + Intergenic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1129804774 15:78446653-78446675 ACAGAGAGACTGAACTGGAAAGG - Intronic
1131138099 15:89953975-89953997 ACATAGAGACTATTCTTAGAGGG + Intergenic
1131302571 15:91212401-91212423 ACACAGGGACTTTAGTGGGAAGG - Intronic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1167736446 19:51297214-51297236 ACAGAGAGACTAGACTTTGAGGG - Intergenic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
931757753 2:65388999-65389021 ACAGAGATTCTGTACTGGGAGGG + Intronic
932347262 2:71003877-71003899 AAATAGAGGCTCTGCTGGGAAGG - Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
932704829 2:74015393-74015415 TAATAGTGATTATACTGGGATGG - Intronic
933120112 2:78525924-78525946 ACATAGAGACTATCCTAGATGGG - Intergenic
933369191 2:81393776-81393798 CCATAGAGACCATCATGGGATGG - Intergenic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG + Intronic
942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG + Intergenic
943466549 2:188235837-188235859 ACAGAGGGACTTTACTGAGAGGG - Intergenic
944445257 2:199782495-199782517 ACATAGCTTCTCTACTGGGAAGG + Intronic
947561592 2:231158659-231158681 ACATAGTAACTAACCTGGGATGG - Intronic
1170101382 20:12703451-12703473 ACATAGACACCATACTGTGGTGG - Intergenic
1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG + Intronic
1176759714 21:10769737-10769759 ACAAAGAGAGTGTTCTGGGAGGG + Intergenic
1179305230 21:40147907-40147929 ACAGAGAAACTATATTGTGAAGG - Intronic
952206577 3:31186370-31186392 ACATAAAGACTATAGTTGGTGGG - Intergenic
952406876 3:33013074-33013096 AGGTAGAGACTAGATTGGGACGG - Intronic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
957946965 3:87077008-87077030 CCATGGGGACTATATTGGGATGG - Intergenic
964144723 3:153445418-153445440 GAATAGAGAGTATACTGTGATGG + Intergenic
964566288 3:158057346-158057368 ACCTAAATAATATACTGGGAAGG - Intergenic
965477936 3:169180751-169180773 ACATAAAGAGAATACTGGAAAGG - Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG + Intergenic
978426924 4:108592969-108592991 AAATAGAGACTATACGGTGGGGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979975982 4:127196851-127196873 ACACAGAGCCTTTGCTGGGATGG - Intergenic
984253527 4:177363550-177363572 ACATAGAGAGTACATTAGGAAGG + Intergenic
985172499 4:187167073-187167095 AAATTGAGACTATACAGGCATGG - Intergenic
988191161 5:27936874-27936896 GGCTAGAGACTATCCTGGGAGGG + Intergenic
991718674 5:69475841-69475863 TCACAGAGACTAGAGTGGGAGGG - Intergenic
991719281 5:69480531-69480553 TCACAGAGACTAGAGTGGGAGGG + Intergenic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG + Intronic
1001760566 5:174204674-174204696 TCATAGAGACTATGCTGTGACGG + Intronic
1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG + Intergenic
1002297869 5:178241395-178241417 CCAGAGAGACTCTTCTGGGAAGG + Intronic
1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG + Intronic
1003974177 6:11327096-11327118 ACATAGGGACTGTACTGGTGTGG + Intronic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1014090758 6:117401258-117401280 GCATGGAGAATAGACTGGGAGGG - Intronic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG + Intergenic
1016975795 6:149806341-149806363 ATGTAGAGACTAGCCTGGGAAGG + Intronic
1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG + Intergenic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1020960502 7:14796975-14796997 GCAAAGAGACTATACTGACATGG + Intronic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1023362642 7:39432081-39432103 ACATAGAGACCATATTGTTAGGG - Intronic
1023542036 7:41275891-41275913 GCCTAGAGACTGTACTGGGAGGG - Intergenic
1024695024 7:51847066-51847088 ACATGAAGTGTATACTGGGAAGG - Intergenic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1028112013 7:86951947-86951969 ACATTGGCACTATACTTGGAGGG + Intronic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1035692066 8:1566704-1566726 GGATAGAGACAATACAGGGAGGG - Intronic
1040968240 8:53106163-53106185 ACATACAGAATATACAGGGAAGG - Intergenic
1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG + Intronic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1044079264 8:87863814-87863836 ACATAGAGTCAACACTGGAATGG - Intergenic
1047360186 8:124162065-124162087 ACGGAGAGACTATATGGGGAAGG + Intergenic
1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG + Intergenic
1055164614 9:73176118-73176140 AAAGAGAGACTTTACTGAGAGGG - Intergenic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1188378589 X:29463965-29463987 ACATAAAGACTGGACTGGGCTGG - Intronic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1193586058 X:83322917-83322939 ACATAGAAAGTGTTCTGGGAAGG + Intergenic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1195383803 X:104295067-104295089 ATATGGAGACTATACTGTTAAGG + Intergenic
1199545834 X:149006658-149006680 ACACAGAGATTATTCTGGGTGGG - Intergenic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic