ID: 979293464

View in Genome Browser
Species Human (GRCh38)
Location 4:119003688-119003710
Sequence TTTAGTATCTTTTATAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 670}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979293461_979293464 10 Left 979293461 4:119003655-119003677 CCCAGTATAGTCTCTATGTTTGC 0: 1
1: 0
2: 1
3: 4
4: 114
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670
979293458_979293464 15 Left 979293458 4:119003650-119003672 CCCCTCCCAGTATAGTCTCTATG 0: 1
1: 0
2: 2
3: 13
4: 124
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670
979293462_979293464 9 Left 979293462 4:119003656-119003678 CCAGTATAGTCTCTATGTTTGCA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670
979293459_979293464 14 Left 979293459 4:119003651-119003673 CCCTCCCAGTATAGTCTCTATGT 0: 1
1: 0
2: 1
3: 10
4: 113
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670
979293460_979293464 13 Left 979293460 4:119003652-119003674 CCTCCCAGTATAGTCTCTATGTT 0: 1
1: 0
2: 1
3: 14
4: 106
Right 979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG 0: 1
1: 0
2: 2
3: 75
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979293464 Original CRISPR TTTAGTATCTTTTATAGTAG AGG Intronic
901011053 1:6202338-6202360 TTTAGTATTTTTTATAGAGGGGG + Intronic
901596971 1:10392965-10392987 TTTAGTACCTCTTTTAGGAGAGG - Intergenic
901865173 1:12101840-12101862 TTTTGTATTTTTTTTAGGAGAGG + Intronic
903088042 1:20881991-20882013 TTTTGTATTTTTTATAGTGATGG - Intronic
903961518 1:27060764-27060786 TTTTTTATATTTTTTAGTAGAGG + Intergenic
904017397 1:27432931-27432953 TTTATTATCTTTTATAGAGATGG + Intronic
904062476 1:27722686-27722708 TTTTGTATTTTTTATAGAGGCGG - Intergenic
904240222 1:29139477-29139499 TTTTGTATTTTTTATAGAAATGG + Intergenic
904568575 1:31443536-31443558 TTTAGTATCTTTAATAGAAACGG + Intergenic
904667212 1:32132458-32132480 TTTTGTATTTTTTATAGAAATGG + Intronic
904727352 1:32559633-32559655 TTTTGTATTTTTTGTAGTAATGG + Intronic
904803221 1:33111770-33111792 TTTTGTATTTTTTTTAGTAGAGG + Intronic
905153746 1:35955763-35955785 TTTTGTATTTTTTATAGAAATGG + Intronic
906077122 1:43060136-43060158 TTTAATCTCTTTTACAGTTGAGG - Intergenic
906185273 1:43857784-43857806 TTTTGTATCTTTAGTAGAAGCGG + Intronic
906213382 1:44024613-44024635 TTTTTTATCTTTTATAGGATTGG - Intronic
906856988 1:49318240-49318262 TTTATTATATTTTATAGTTTAGG - Intronic
906889968 1:49700436-49700458 TTTGGTATTTTTTACAGTAAGGG - Intronic
906903415 1:49862877-49862899 TTTAGCATTTCTTATAGGAGAGG - Intronic
906953395 1:50352038-50352060 TTTTGTATTTTTTGTAGAAGTGG - Intergenic
906967045 1:50468036-50468058 TTTTGTATTTTTTATAGAAATGG - Intronic
907041684 1:51266631-51266653 TTTTGTATCTTTTATAGAGACGG + Intronic
907339053 1:53720826-53720848 TGTTGTATGTTTTGTAGTAGTGG - Intronic
907511450 1:54964126-54964148 TTTTGTATCTTTTGTAGAAACGG + Intergenic
908246232 1:62229521-62229543 TTTTGTATCTTTTGTAGATGGGG - Intergenic
909209520 1:72806163-72806185 TTTAGTATTTATTGTAGGAGAGG + Intergenic
909864189 1:80645947-80645969 TTTTGTATGTTTTATTCTAGAGG - Intergenic
909934636 1:81537451-81537473 TTTTGTATTTTTTTTAGTAGAGG + Intronic
911065927 1:93788477-93788499 TTTAGCATTTCTTATAGCAGTGG + Intronic
911647231 1:100350258-100350280 TTTTGTATTTTTTTAAGTAGAGG + Intergenic
912245863 1:107961195-107961217 TATACTATGCTTTATAGTAGGGG - Intronic
912685678 1:111761392-111761414 TCTTGTATCTTTTAGAGTAAAGG + Intronic
913305469 1:117425987-117426009 TTTAACATTTTTTATAGTATAGG + Intronic
914320334 1:146553116-146553138 TTTATTTTATTTTATTGTAGAGG - Intergenic
914492895 1:148163374-148163396 TTTATTATTTTTTATAGATGAGG - Intergenic
914790355 1:150872126-150872148 TTTTGTATTTTTTGTAGTAAAGG + Intronic
915175686 1:154012834-154012856 TTTTGTGTTTTTTTTAGTAGAGG - Intronic
915256776 1:154637968-154637990 TTTTGTATTTTTTATAGAAATGG - Intergenic
915329317 1:155100023-155100045 TTTCGTATTTTTTTTAGTATAGG - Intergenic
915767842 1:158384326-158384348 TTTATTATCTTTCTTAGTAAAGG - Intergenic
916157876 1:161874721-161874743 TTGAATATCTATTCTAGTAGAGG + Intronic
916262285 1:162854367-162854389 TTTAGTTTGATATATAGTAGTGG - Exonic
916401635 1:164454991-164455013 TTTAGTATTTTTTATAATGTGGG - Intergenic
916540124 1:165745333-165745355 TTTAGTATCCCTTATAGTCTTGG + Intronic
916701712 1:167302429-167302451 TTTTGTATCTTTTAGAGACGGGG + Intronic
916851339 1:168707373-168707395 TCTAGAATCTATTATAGTAGAGG + Intronic
917893156 1:179459613-179459635 TTTGGTATTTTCTATAGTGGTGG + Intronic
918285336 1:183049092-183049114 TTTAGTTTCTTCTATAAGAGTGG - Intronic
918385057 1:183997450-183997472 CTTAGTATTTTTTATAGCAGAGG + Intronic
918614934 1:186533082-186533104 GTTAGTATCTTTCTGAGTAGAGG - Intergenic
918905069 1:190481020-190481042 TTTAGTATATTTTATATTATTGG + Intergenic
919252592 1:195076700-195076722 TTTAGTACCTGGTATAGTCGAGG - Intergenic
919469864 1:197964816-197964838 TTTCGTATCTTTTATAGAGATGG + Intergenic
919470221 1:197969240-197969262 TTTTTTATCTCTTATAGTGGAGG + Intergenic
919526067 1:198652482-198652504 TTTATTATCTTTTATTGGATAGG - Intronic
919782092 1:201227598-201227620 TTTTGTATTTTTAATAGAAGGGG + Intronic
920357640 1:205386471-205386493 TTTTTTATATTTTTTAGTAGAGG + Intronic
920455416 1:206097493-206097515 TTTAGTTTCGTTTATAAAAGTGG - Intronic
921002046 1:211054100-211054122 TTTTGTATTATTTTTAGTAGAGG - Intronic
921379632 1:214511268-214511290 ATTAGTACCTTTTGTAGTACGGG - Intronic
921541191 1:216417800-216417822 TCCGGTATTTTTTATAGTAGTGG + Intronic
921565133 1:216708277-216708299 TTTATTATCTTTTATATTCCAGG - Intronic
921706486 1:218327472-218327494 TTTTGTATTTTTAATAGAAGCGG + Intronic
921743314 1:218710527-218710549 TTTAGAATCATTTTAAGTAGAGG + Intergenic
921764688 1:218957099-218957121 TTTATTACTTTTTATAGTATAGG + Intergenic
922287199 1:224180828-224180850 TTTTGTATTTTTTATAGAGGTGG + Intronic
923593500 1:235341157-235341179 TTTTGTATATTTTATAGAAAGGG - Intronic
924408815 1:243781991-243782013 TTTTGTATTTTTTGTAGAAGTGG + Intronic
1063397917 10:5708870-5708892 TTTTGTATTTTTTATAGAGGTGG + Intronic
1063997564 10:11634837-11634859 TTTTGTATCTTTAGTAGTGGTGG - Intergenic
1064645898 10:17459306-17459328 TTTGGTATTTTTTATAGAGGAGG - Intergenic
1064884415 10:20093843-20093865 TTTTGTATTTTTGATAGAAGTGG + Intronic
1065087849 10:22197852-22197874 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
1065243907 10:23738089-23738111 TTTAGCATTTGTTATTGTAGAGG + Intronic
1065927647 10:30449678-30449700 TTTTGTATTTTTTGTAGTAACGG + Intronic
1066572757 10:36791196-36791218 TTTTATATTTTTTTTAGTAGAGG - Intergenic
1066958112 10:42192065-42192087 TTTTGTATTTTTTTTAGTGGAGG - Intergenic
1067123968 10:43499578-43499600 TTTTGTATTTTTTATAGAAATGG - Intergenic
1068234488 10:54215870-54215892 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1068939369 10:62665764-62665786 TCTATTGTCTTTTATAGCAGGGG - Intronic
1068979352 10:63044937-63044959 TTTAGCATTTTTTGTAGGAGAGG - Intergenic
1069397530 10:68006309-68006331 TTTAGCATTTCTTATAGTACAGG + Intronic
1069525533 10:69167258-69167280 TTTTGTATTTTTTATAGAAATGG - Intronic
1069950533 10:72015383-72015405 TTTTGTATTTTTTGTAGTAATGG + Intergenic
1070522430 10:77265908-77265930 TTTTGTATTTTTTATAGAAATGG - Intronic
1070663283 10:78323982-78324004 TTTTGTAGCTTTCATTGTAGAGG + Intergenic
1071694231 10:87854984-87855006 GTTAGTAACTTTTATTGAAGCGG + Intergenic
1071840774 10:89468957-89468979 TTTTGTATTTTTTATAGAAATGG - Intronic
1072072165 10:91928982-91929004 TTTTGTATATTTTGTAGAAGTGG + Intronic
1072559568 10:96558473-96558495 TTTTGTATTTTTTTTAGTAGGGG - Intronic
1073093389 10:100964624-100964646 TTTTGTATCTTTTACATTTGAGG - Intronic
1073219753 10:101861418-101861440 TTTAATATCTCTTGTAGTACAGG - Intronic
1073603483 10:104869815-104869837 TCAAACATCTTTTATAGTAGAGG + Intronic
1073603588 10:104870896-104870918 TTGAACATCTTTTATAGTGGAGG + Intronic
1073634429 10:105182871-105182893 TTTTGTATTTTTTATAGAGGTGG + Intronic
1074038622 10:109765968-109765990 TTCAGTATCTTTATCAGTAGAGG + Intergenic
1074607373 10:114986803-114986825 TTTAATATTTTTTATAGCACAGG + Intergenic
1075496571 10:122924770-122924792 TTTAGCATTTTTTATAGGACAGG - Intergenic
1075527508 10:123199039-123199061 TTGAGTATCTTTTTTAGTCTAGG - Intergenic
1076360261 10:129883430-129883452 GTTGGTATCTTTTATTGTGGGGG + Intronic
1078235051 11:9476929-9476951 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1078459666 11:11504584-11504606 TTTTGTATTTTTTATAGAAATGG - Intronic
1078525933 11:12101298-12101320 TTTAATATCTTTTATGGGGGGGG + Intronic
1078701681 11:13690889-13690911 TTTAGTAGGTTTTAGAATAGAGG + Intronic
1078961724 11:16281757-16281779 TTTTGAATCTTTTATAATATTGG - Intronic
1079687050 11:23372314-23372336 TTTAGTATTGCTTATAGTACAGG - Intergenic
1080052893 11:27874739-27874761 ATTATTATCCTTTATAGAAGAGG - Intergenic
1081093451 11:38901116-38901138 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
1081511871 11:43782823-43782845 AATAGTAACTTTTATAGTGGAGG + Intronic
1081518935 11:43862757-43862779 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1081539851 11:44025705-44025727 TTTAGTATTTCTTATAGGATTGG + Intergenic
1082048314 11:47748817-47748839 TTTAGTATTTTTAATAGACGGGG + Intronic
1082201504 11:49376381-49376403 TTTAGTGTCCTTTATAGTGCTGG + Intergenic
1082213132 11:49530798-49530820 ATTGGATTCTTTTATAGTAGTGG - Intergenic
1083021364 11:59510728-59510750 TTTTGTATTTTTAATAGAAGTGG - Intergenic
1083068556 11:59951218-59951240 TTTAGGATCTGTTATTGTGGAGG - Intergenic
1083649747 11:64195282-64195304 TTTTGTATGTTTAGTAGTAGCGG + Intronic
1084050229 11:66594603-66594625 TTTTGTATATTTTATAGAGGAGG - Intronic
1084906995 11:72356112-72356134 ATTTGTATTTTTTTTAGTAGAGG - Intronic
1085020740 11:73205249-73205271 TTTATCATCTTTTATTGTAAAGG + Intergenic
1085576295 11:77606714-77606736 TTTTGTATTTTTTATAGAAATGG + Intronic
1085576301 11:77606765-77606787 TTTTGTATTTTTTATAGAAACGG + Intronic
1085814580 11:79723887-79723909 TTTAGTATTTCTTATAGGACAGG - Intergenic
1086231124 11:84571088-84571110 TTTACTCCCTTTTATAGTATAGG - Intronic
1086654164 11:89329858-89329880 TTTAGTGTCCTTTATAGTGCTGG - Intronic
1086869614 11:92021130-92021152 TTTCATATATTTTATAGTACAGG + Intergenic
1087240288 11:95767470-95767492 TTAAGTACCTTTTATACTATAGG + Intergenic
1087295662 11:96370342-96370364 TTTATGATCTTTAATAGCAGAGG - Intronic
1087350282 11:97022149-97022171 TTTAGCATTTTTTGTAGGAGAGG - Intergenic
1087650627 11:100862865-100862887 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1087754371 11:102039441-102039463 TTTAGTATTTCTTATAATTGAGG - Intergenic
1088387879 11:109280125-109280147 TTTAGCATTTCTTATAGTGGTGG + Intergenic
1088609015 11:111559627-111559649 TTTTGTATCTTTTATAGGGACGG + Intronic
1088848500 11:113687217-113687239 TTTTGTATCTTTTGTAGAAATGG - Intergenic
1089089223 11:115853989-115854011 TTCAGTATTTATTATAGTATAGG - Intergenic
1089487538 11:118858602-118858624 TTTTGTAATTTTTTTAGTAGAGG + Intergenic
1089570510 11:119405541-119405563 TTTTGTATGTTTTTTAGTAGAGG + Intergenic
1089705860 11:120276975-120276997 TTTTGTATTTTTTATAGAGGTGG - Intronic
1090057209 11:123433426-123433448 TTTAGTTTCTTTTACATTGGAGG - Intronic
1090058254 11:123441613-123441635 TTTTTTTTCTTTTATAATAGAGG - Intergenic
1091125961 11:133098042-133098064 TGTAGTATCTTTTATGGTTTTGG - Intronic
1091166102 11:133477559-133477581 TTTTTTTTCTTTTAGAGTAGAGG + Intronic
1091633908 12:2183041-2183063 TTTAGTATTTTTAATAGAAATGG + Intronic
1092994800 12:13939715-13939737 TTTTGTATCATTTTTAGTAGAGG + Intronic
1093062867 12:14625500-14625522 TTTATTATTATTTTTAGTAGAGG + Intronic
1093142583 12:15526615-15526637 TTTAATATCTTAAATAGTAATGG + Intronic
1093169333 12:15841872-15841894 TTTAGTATCTTCTATATTCCAGG - Intronic
1093468606 12:19477064-19477086 TTTTGTAGCTTTTGTAATAGGGG + Intronic
1093489722 12:19690869-19690891 TATAATATCTTTATTAGTAGAGG - Intronic
1093562699 12:20561088-20561110 TTTTGTATCTTTAGTAGAAGTGG - Intronic
1093776258 12:23077940-23077962 TTTATTATATTTTATTGTAGAGG - Intergenic
1094353649 12:29554696-29554718 TTTTGTATTTTTTGTAGAAGTGG - Intronic
1094407877 12:30137867-30137889 TTTTCTTTCTTTTATAATAGTGG - Intergenic
1095212835 12:39512986-39513008 TTTAGTATTTTTTGTAGAACAGG - Intergenic
1097085600 12:56465842-56465864 TTTAGTATATTTGAGAGTGGTGG - Intronic
1097096570 12:56553632-56553654 TTTTGTATTTCTTTTAGTAGAGG + Intronic
1097199438 12:57265965-57265987 TTTTGTATTTTTAATAGAAGTGG + Intronic
1097370904 12:58779602-58779624 TTTAGTATCTCTTATAGGGTAGG - Intronic
1097537204 12:60887677-60887699 TTTAGCAGTTTTTGTAGTAGTGG + Intergenic
1097906798 12:64928851-64928873 TTTAGTATTTCTTATAGTGCTGG + Intergenic
1097977639 12:65705468-65705490 TTTAGAATGTTTTATAATACAGG + Intergenic
1098297092 12:69015080-69015102 TTTAGTTTCTTGTGCAGTAGCGG + Intergenic
1098531851 12:71550632-71550654 TTTTGTATTTTTTATAGAAATGG + Intronic
1098556907 12:71829418-71829440 TTTTGTATCTTTTATAGAGACGG + Intergenic
1098969382 12:76833893-76833915 CTTCGTATTATTTATAGTAGGGG + Intronic
1099609898 12:84855413-84855435 TTTAGCATTTTTTGTAGAAGAGG + Intergenic
1099822612 12:87732244-87732266 GTTAGTAACTTTTATTGAAGTGG - Intergenic
1101378878 12:104195420-104195442 TTTTGTATTTTTGTTAGTAGAGG + Intergenic
1101893768 12:108739016-108739038 TTTTGTATCTTTTGTAGAAATGG + Intergenic
1101898855 12:108776141-108776163 TTTTGTATTTTTAATAGAAGCGG + Intergenic
1102386007 12:112510899-112510921 TTTAGTATCTTTAATAGAGGCGG - Intergenic
1102481216 12:113224919-113224941 TTTTGTATCTTTAATAGAGGCGG + Intronic
1103441791 12:120968415-120968437 TTTTGTATTTTTAATAGAAGCGG + Intergenic
1103680441 12:122689648-122689670 TTTTGTATTTTTTATAGAAACGG - Intergenic
1104288173 12:127444332-127444354 TTTTGTAGTTTTTTTAGTAGAGG - Intergenic
1104448360 12:128851081-128851103 TTTTGTATTTTTTGTAGAAGTGG - Intergenic
1104523985 12:129500737-129500759 TGTAGTTTCTTTTATCGCAGAGG - Intronic
1104753567 12:131255101-131255123 TTTTGTATCTTTTGTAGAAATGG + Intergenic
1105010562 12:132753458-132753480 TTTTGTATTTTTTATAGAGGCGG - Intronic
1105211989 13:18262312-18262334 TTTATTATTTTTTTTAGGAGGGG + Intergenic
1105355516 13:19655940-19655962 TTTTGTATTTTTTGTAGAAGTGG - Intronic
1105553034 13:21416032-21416054 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1105827766 13:24137587-24137609 TTTTGTATTTTTTGTAGTGGTGG - Intronic
1106362865 13:29048773-29048795 TTTTGTATTTTTTATAGTGGTGG + Intronic
1106740093 13:32631261-32631283 TTTTGTATTTTTTGTAGTGGTGG + Intronic
1107227144 13:38065273-38065295 TTTAGTATTTCTTTTAGTATTGG + Intergenic
1107619041 13:42205964-42205986 TTTAGTATCTTCCATACTAGTGG + Intronic
1107751437 13:43571508-43571530 TTTTTTTTCTTTTTTAGTAGAGG - Intronic
1108373724 13:49794317-49794339 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
1108375686 13:49811894-49811916 TTTAGTATTTTTTATAGGGATGG - Intergenic
1108888335 13:55219915-55219937 TTTAGTATCTTTCATATTTTTGG - Intergenic
1109073479 13:57801678-57801700 ATTAGTATCTTTTGTAGTGCAGG + Intergenic
1109336489 13:61001674-61001696 TTTAGTATTTCTTGTAGGAGAGG + Intergenic
1109613455 13:64797206-64797228 TTTAGAATTTCTTTTAGTAGAGG + Intergenic
1109642422 13:65207925-65207947 TTGATTATCTTCTATAGTTGAGG + Intergenic
1109723992 13:66315649-66315671 TTTTGTATCTTTAATAGTGACGG + Intronic
1109879683 13:68455131-68455153 TTTAGTAATTTTTAGTGTAGTGG - Intergenic
1109985193 13:69972095-69972117 TAGATTATCTTTAATAGTAGAGG - Intronic
1110097175 13:71542075-71542097 TTTAGTATTTTTAATAGTGAAGG - Intronic
1111273757 13:85920712-85920734 ATTAGTATTTTTTATTGAAGAGG + Intergenic
1112774541 13:102829883-102829905 TTTACTATCTTTTATTTCAGAGG + Intronic
1113143558 13:107182442-107182464 TTTTGTATTTTTTGTAGAAGTGG + Intronic
1113315468 13:109174917-109174939 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1113845456 13:113386982-113387004 TTTAGTAGTTCTTATAGTGGTGG + Intergenic
1114161225 14:20169938-20169960 TTTTGTATTTTTTATAGAGGTGG + Intergenic
1114275404 14:21138996-21139018 TTTTGTATTTTTTTTACTAGAGG - Intergenic
1114496307 14:23135256-23135278 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1114521477 14:23341077-23341099 TTTACTATCCATTATAGTAAAGG - Intergenic
1115358818 14:32478538-32478560 TTTTGTTTTTTTTATGGTAGAGG - Intronic
1115467450 14:33731227-33731249 TTTAGTATTTTTTGTAGATGGGG - Intronic
1116137164 14:40941249-40941271 TGTATTTTTTTTTATAGTAGAGG - Intergenic
1116293344 14:43072305-43072327 GTTAGTATACTTTATATTAGTGG - Intergenic
1116351043 14:43863337-43863359 TTCAGTATTTTTTGTAGTACAGG + Intergenic
1116468312 14:45258113-45258135 TTTAGTATTTCTTATAGTATAGG + Intergenic
1116754809 14:48933997-48934019 TTCAGTATCATTTGTAGTAAAGG - Intergenic
1117155475 14:52935875-52935897 GTTAGTATGTCTTATAGTATCGG - Intronic
1118259098 14:64231055-64231077 TTTTGTATCTTTTGTAGGACAGG + Intronic
1118361872 14:65063733-65063755 TTTTGTATTTTTTATAGAAATGG + Intronic
1119073682 14:71614027-71614049 TTTTCTATTTTTTTTAGTAGAGG - Intronic
1119256808 14:73205305-73205327 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1120965996 14:90168201-90168223 TTTTGTATCTTTTATAGAGATGG - Intronic
1121359253 14:93241321-93241343 TTTTGTATTTTTTATAGAAATGG + Exonic
1121363180 14:93281302-93281324 TTTTGTATTTTTTTTTGTAGAGG + Intronic
1121971092 14:98356714-98356736 ATTAGTATCTTTTATATTTGTGG + Intergenic
1122432846 14:101666870-101666892 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1202935010 14_KI270725v1_random:79832-79854 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1123970717 15:25505566-25505588 TCTAGTATCTTCTAGTGTAGAGG + Intergenic
1124054288 15:26227455-26227477 TTTAGCATCTTTTGTAGTGAAGG - Intergenic
1124502103 15:30237503-30237525 TTTTGTAGCTTTTCTTGTAGAGG + Intergenic
1124741461 15:32301149-32301171 TTTTGTAGCTTTTCTTGTAGAGG - Intergenic
1125111076 15:36034903-36034925 TTTTGTTCCTTTTATTGTAGGGG - Intergenic
1125296086 15:38204747-38204769 TATAGTATCTTTTACAATAAGGG + Intergenic
1125540023 15:40464875-40464897 TTTGGTATTTTCTGTAGTAGGGG + Intronic
1125695704 15:41635521-41635543 TTTAAAATTTTTTATAGGAGGGG - Intronic
1125774107 15:42195402-42195424 TTTTGTATCTTTTGTAGTGATGG - Intronic
1127418782 15:58784153-58784175 TTTTGTATTTTTTATAGAGGTGG - Intronic
1127516887 15:59704303-59704325 TGAAGCATCTTTTATAGTATCGG + Intergenic
1127614677 15:60672078-60672100 TTTATTATTTTTTTTAGAAGGGG - Intronic
1128228056 15:66016235-66016257 ATTAGGATCATTTATAGAAGAGG + Intronic
1128486793 15:68100346-68100368 TTAGGTATCTTTTATTGTGGTGG - Intronic
1128906774 15:71474388-71474410 TTTTGTAGTTTTTTTAGTAGAGG + Intronic
1128955619 15:71940322-71940344 TTTTGTATTTTTTATAGAGGTGG - Intronic
1129142473 15:73612596-73612618 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1130321627 15:82847245-82847267 TTTACTTTCTTTTAAAATAGTGG - Intronic
1130337330 15:82967704-82967726 TTTTGTATTTTTAGTAGTAGAGG - Intronic
1130645130 15:85718727-85718749 TTTTGTATTTTTTATAGAAATGG - Intronic
1130743862 15:86629660-86629682 TTTAGTCATTTTTATAGTACTGG + Intronic
1131089615 15:89613093-89613115 TTTAGTATTATTTATAGTGTAGG + Intronic
1131151085 15:90047752-90047774 TTTTGTATTTTTTCTAGTAGAGG + Intronic
1131850800 15:96541380-96541402 TTTTGTATTTTTTATAGAAACGG + Intergenic
1133209537 16:4255763-4255785 TTTTTTATATTTTATTGTAGAGG - Intergenic
1133568107 16:7014412-7014434 TTTATTTTTTTTTAAAGTAGGGG + Intronic
1133745620 16:8684400-8684422 TTTAGTATTTTTTGTAGAGGCGG - Intronic
1134152073 16:11812859-11812881 TTTTGTATTTTTTTTAATAGAGG - Intergenic
1134865739 16:17605179-17605201 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1135198468 16:20415222-20415244 TTTAATGTCTTTTATAATATAGG - Intronic
1135310514 16:21401509-21401531 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1135363460 16:21833939-21833961 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1135448331 16:22537141-22537163 TTTTGTATTTTTTTCAGTAGAGG - Intergenic
1135470622 16:22726553-22726575 TTTTGTATTTTTTATAGAAACGG + Intergenic
1135814740 16:25622292-25622314 TTGAGTATCTTTTATATTCCAGG - Intergenic
1135929577 16:26725205-26725227 TTTAGTACTTTTTAAAGAAGTGG + Intergenic
1136150096 16:28341860-28341882 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1136166332 16:28455675-28455697 TTTTGTATGTTTTTCAGTAGAGG + Intergenic
1136196641 16:28659357-28659379 TTTTGTATGTTTTTCAGTAGAGG - Intergenic
1136212981 16:28773482-28773504 TTTTGTATGTTTTTCAGTAGAGG - Intergenic
1136257708 16:29053397-29053419 TTTTGTATGTTTTTCAGTAGAGG - Intergenic
1136307258 16:29380667-29380689 TTTTGTATGTTTTTCAGTAGAGG + Intergenic
1136320784 16:29482910-29482932 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1136435357 16:30222250-30222272 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1138264903 16:55653422-55653444 TTTAGTATCTCTCATACTACTGG + Intergenic
1139025849 16:62816735-62816757 TTTTGTATTTTTAATAGAAGTGG + Intergenic
1139070738 16:63379172-63379194 TTTAATATTTTTTAAAGTAATGG + Intergenic
1139164526 16:64550295-64550317 TTTTGTATGTTTAATAGCAGTGG - Intergenic
1139855391 16:69975661-69975683 TTTTGTATGTTTTTCAGTAGAGG + Intergenic
1139885107 16:70202774-70202796 TTTTGTATTTTTTTCAGTAGAGG + Intergenic
1140013199 16:71156990-71157012 TTTATTTTATTTTATTGTAGAGG + Intronic
1140095726 16:71874127-71874149 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1140167787 16:72572084-72572106 TTTTGTATATTTTTTTGTAGAGG - Intergenic
1140280257 16:73547324-73547346 TTTATTAGCTTTGATAGTACAGG - Intergenic
1140367410 16:74392737-74392759 TTTTGTATGTTTTTCAGTAGAGG - Intergenic
1142629214 17:1213558-1213580 TTTTGTATTTTTTTAAGTAGAGG + Intronic
1143343341 17:6231549-6231571 TTTTGTATTTTTTATAGAAATGG - Intergenic
1143566615 17:7725601-7725623 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1143953256 17:10650142-10650164 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1144940384 17:18935358-18935380 TTTTGTATTTTTTGTAGTAATGG + Intergenic
1145715897 17:27020791-27020813 TTTTGTATTTTTTATAGAGGTGG + Intergenic
1145721501 17:27077331-27077353 TTTTGTATTTTTTGTAGCAGTGG - Intergenic
1146298711 17:31671681-31671703 TTTTGTATTTTTTATAGCAATGG - Intergenic
1146480104 17:33198177-33198199 TTTAGTATCTTTTGTAGAGATGG - Intronic
1147349746 17:39832043-39832065 TTTGGTATTTTTTTTAGTAAAGG + Intronic
1147428900 17:40359584-40359606 TTTTGTATTTTTTTTTGTAGAGG - Intergenic
1147804731 17:43122875-43122897 TTTTTTTTCTTTTTTAGTAGAGG - Intronic
1148171911 17:45528296-45528318 TTTTTTATTTTTTATAGTTGGGG + Intergenic
1148319655 17:46739633-46739655 TTTATTTTTTTTTTTAGTAGAGG - Intronic
1148364110 17:47040268-47040290 TTTTTTATTTTTTATAGTTGGGG - Intronic
1148400700 17:47357583-47357605 TTTTGTATTTTTCATAGAAGTGG + Intronic
1148470130 17:47888088-47888110 TTTAGTAGCATTTTTAGTAGAGG + Intergenic
1148671867 17:49416488-49416510 TTTTGTAGTTTTTATTGTAGAGG + Intronic
1148824883 17:50385289-50385311 TTTGGTATGTTTTGTTGTAGAGG - Exonic
1149487586 17:57055243-57055265 TTTTGTATTTTTTATAGAAATGG + Intergenic
1149815925 17:59723862-59723884 TTTAGTAGGCTTAATAGTAGTGG + Intronic
1149889125 17:60370591-60370613 TTTTGTATTTTTTTTTGTAGAGG - Intronic
1150065843 17:62108708-62108730 TTTAATATCTATTATCTTAGAGG + Intergenic
1150096872 17:62384442-62384464 TTTTGTATCTTTTTTGGTAGAGG - Intronic
1150907571 17:69354700-69354722 TTTTGTATTTTTTATAGAGGAGG + Intergenic
1150947100 17:69759750-69759772 TGTGGTATTTTTTATAGCAGTGG + Intergenic
1151317142 17:73329932-73329954 TTTACTTTCTTTTAAAATAGAGG - Intergenic
1152501485 17:80713236-80713258 TTTTGTATTTTTTTTAGTACAGG + Intronic
1153005390 18:494049-494071 TTTTCTATTTGTTATAGTAGTGG - Intronic
1153065632 18:1041353-1041375 TTTAGTAGCTCTTGTAGTGGAGG - Intergenic
1153467507 18:5405617-5405639 TTTTGTATTTTTAATAGAAGTGG - Intronic
1153738904 18:8101916-8101938 TTTATTGTCTTTTCTAGTACAGG + Intronic
1153899156 18:9600706-9600728 TTTTGTATCTTTTATAGAGATGG - Intronic
1153999610 18:10472427-10472449 TTTAGTATCTTTTCCAGGTGTGG - Intronic
1154116813 18:11618630-11618652 TTTTGTATGTTTTTCAGTAGAGG + Intergenic
1154171500 18:12056338-12056360 TTGAGTTTCTTTTCAAGTAGGGG - Intergenic
1154944539 18:21148552-21148574 TTTTGTATCTTTTATAGAGATGG + Intergenic
1155667156 18:28325242-28325264 TTTAGTATTTTCTATAGTGTGGG - Intergenic
1155673526 18:28401480-28401502 TTTATGATCTTTTATAGAAGAGG - Intergenic
1155892644 18:31287420-31287442 TTCTGTAACTCTTATAGTAGAGG - Intergenic
1156075370 18:33270700-33270722 TTGAGTATTTTTTATAGAACAGG - Intronic
1156080908 18:33333823-33333845 TATAGTACCTTTTATTTTAGAGG - Intronic
1157073760 18:44441342-44441364 TGCAGTATCTTTTATATTAATGG + Intergenic
1158617933 18:59005143-59005165 TTTTGTATTTTTTCTAGTAGAGG + Intergenic
1159648274 18:70945120-70945142 TTTAGCATTTCTTGTAGTAGAGG - Intergenic
1161356903 19:3824127-3824149 TTTTGTATTTTTTTTTGTAGAGG - Intronic
1162490480 19:10988288-10988310 TTTTGTATTTATTTTAGTAGAGG + Intronic
1162545848 19:11329087-11329109 TTTGGTATTTTTTATAGGGGTGG + Intronic
1162763382 19:12902379-12902401 TTTTGTATCTTTTCTACTAGAGG + Intronic
1163114805 19:15182334-15182356 TTTTGTATTTTTTATAGAAATGG - Intronic
1163341189 19:16708268-16708290 TTTTGTATCTTTAATAGAGGAGG + Intergenic
1163495595 19:17644860-17644882 TTTTGTATCTTTTATAGAGATGG + Intronic
1163511532 19:17738421-17738443 TTTTGTATCTTTTGTAGACGGGG - Intergenic
1163891838 19:20023552-20023574 TTTAGAATATTTTATATTTGTGG + Intronic
1164025658 19:21349777-21349799 TTTTGTATCTTTTGTAGACGTGG - Intergenic
1164072606 19:21782236-21782258 TTTAGTATTTTGTATATTAGGGG + Intergenic
1164423408 19:28118086-28118108 TTTAATTTTTTTTTTAGTAGAGG - Intergenic
1165411662 19:35666036-35666058 TTTTGTATTTTTTATAGAAACGG + Intergenic
1165643839 19:37416060-37416082 TTTTGTATCTTTTGTAGAAATGG - Intronic
1166626833 19:44365281-44365303 TTTTGTATCTTTTGTAGAGGTGG - Intronic
1166668376 19:44695282-44695304 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1167597222 19:50434185-50434207 TTTAGTATTTTTTGTAGTGACGG - Intronic
1167974894 19:53217346-53217368 GTTAGTATCTTTTGTCATAGTGG + Intergenic
1168542079 19:57221219-57221241 TTTTGTATTTTTAGTAGTAGTGG + Exonic
925531875 2:4872808-4872830 TTTATTATTATTTATAGTGGGGG - Intergenic
925965253 2:9059543-9059565 TTTAGTTTATTTTAGAGTAGAGG - Intergenic
926106325 2:10154304-10154326 TTTTGTATTTATTTTAGTAGAGG - Intronic
926995560 2:18731546-18731568 TCTAGTATTTTTTATAGTTTTGG + Intergenic
927134213 2:20084841-20084863 TTTGGTAACTCTTACAGTAGAGG + Intergenic
927536325 2:23863133-23863155 TTTTGTATTTTTTATAGAGGTGG - Intronic
927765152 2:25800124-25800146 TTTTGTATTTTTTTTTGTAGAGG - Intronic
927906107 2:26858545-26858567 TTTCATATCTTTTATAATATAGG + Intronic
927916620 2:26941105-26941127 TTTTGTATTTTTTATAGAGGCGG + Intronic
930667398 2:54113411-54113433 TTTTGTATTTTTTATAGAGGCGG + Intronic
930729598 2:54714843-54714865 TTTTGGATCTCTTATAATAGGGG - Intergenic
931330235 2:61273545-61273567 TTTAGTATCTTTGATAGAGAAGG - Intronic
931456115 2:62411004-62411026 TTTATTATTTATTATAGCAGGGG + Intergenic
931476673 2:62594702-62594724 TTTTGTATGTTTTATAGAGGTGG + Intergenic
931534338 2:63255986-63256008 TTTTGTAGTTTTCATAGTAGTGG - Intronic
931660708 2:64559873-64559895 TTTTGTATTTTTTATAGAAATGG + Intronic
933416974 2:81998564-81998586 TTCAGGATCTTGTAAAGTAGTGG + Intergenic
933605388 2:84377034-84377056 TTTATTGTCTTTTATAATTGTGG - Intergenic
933856227 2:86417297-86417319 TTTGGTTTCTTTTATAGCAATGG - Intergenic
934306230 2:91824456-91824478 TTTTGTATTTTTTTTAGTGGAGG - Intergenic
934327026 2:92028286-92028308 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
934465405 2:94258854-94258876 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
936237099 2:110751904-110751926 TTTAGTATCTGTTGTAGTTGTGG - Intronic
937183331 2:120015152-120015174 TTTGTTATTTTTTTTAGTAGAGG - Intronic
937685784 2:124695581-124695603 TTTCATATCATTTATAATAGAGG + Intronic
939628364 2:144506141-144506163 TTTAGTAGGATTTATTGTAGGGG - Intronic
939794519 2:146625711-146625733 TTTAGAATTTTTTTTAGTTGTGG - Intergenic
939818430 2:146925343-146925365 TTTAGCATTTCTTATAGTACAGG - Intergenic
940251165 2:151678584-151678606 TTTAGAATTTTTAGTAGTAGTGG + Intronic
940381762 2:153023154-153023176 ATTTGTATCTTTTTTATTAGAGG - Intergenic
940432428 2:153609110-153609132 TTTAGTATTTTTTGTAGAACTGG + Intergenic
940772800 2:157857026-157857048 TTTTGTATTTTTTATAGAAGCGG - Intronic
941106660 2:161362296-161362318 TGCTCTATCTTTTATAGTAGGGG - Intronic
941156894 2:161989934-161989956 TTCATTAACTTTTATGGTAGTGG + Intergenic
941229872 2:162898412-162898434 TTTATTACTTTTTATATTAGAGG + Intergenic
941242042 2:163051393-163051415 TTTTGTATTTTTTTTAATAGAGG - Intergenic
941255120 2:163219628-163219650 TTTTGTATTTTTTATAGAAAAGG - Intergenic
941402031 2:165043174-165043196 TTTAGCATTTTTTATAGTGCTGG + Intergenic
942245834 2:174006956-174006978 TTGTGTATATTTTATGGTAGTGG - Intergenic
942962279 2:181845553-181845575 ATTAGTTTCTTTTTTAGGAGGGG + Intergenic
943226942 2:185189728-185189750 TTAAGTATATTTTATAGTTTTGG + Intergenic
943354274 2:186832287-186832309 TTTTGTTTTTTTTTTAGTAGAGG + Intronic
943459455 2:188153434-188153456 TTTAGTTTCTTCTTTACTAGTGG - Intergenic
943689134 2:190851004-190851026 TTTTGTATTTTGTTTAGTAGAGG + Intergenic
944406103 2:199385440-199385462 TTTTGTTTGTTTTAAAGTAGGGG - Intronic
944498940 2:200338193-200338215 TTTTGTATTTTTTATAGAAATGG + Intronic
945567211 2:211415286-211415308 TTTTGTATTTTTTTTAGTAGAGG + Intronic
945739422 2:213642383-213642405 TTTAGTATTTCTTATAGGACAGG + Intronic
946816111 2:223580163-223580185 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
946905274 2:224409733-224409755 TTTTGTATTTTTTTTTGTAGAGG - Intergenic
947598902 2:231432528-231432550 TTTTGTATTTTTTATAGAAATGG + Intergenic
948232548 2:236361642-236361664 TTTATTTTCTTTTTTAGTGGTGG - Intronic
1168737414 20:153634-153656 TTTTGTATCTTTTATAGAGAGGG - Intergenic
1168886489 20:1262899-1262921 TTTTGTATTTTTTATAGAGGTGG + Intronic
1169435654 20:5587013-5587035 TTTATGTTCTTTTTTAGTAGGGG - Intronic
1169988936 20:11476873-11476895 TTTAGCATTTTTTATAGTACAGG - Intergenic
1170425494 20:16231304-16231326 TTTCCTTTCTTTTATAGTTGAGG - Intergenic
1170760284 20:19242773-19242795 ATTGGTTTCTTTCATAGTAGGGG + Intronic
1171470059 20:25363093-25363115 TTCAGAGTATTTTATAGTAGAGG + Intronic
1171479575 20:25443647-25443669 TTTTGTATATTTTTTAGTAGAGG + Intronic
1171479638 20:25444180-25444202 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1172549073 20:35784878-35784900 TTTTGTATTTTTTATAGAGGCGG - Intronic
1173936323 20:46868901-46868923 TTTAGTATTTCTTATAGCACAGG + Intergenic
1174022904 20:47545883-47545905 TTTTGTATTTTTTATAGTGATGG + Intronic
1174832686 20:53827542-53827564 TTTATCATCTTTTATACTGGAGG - Intergenic
1175089702 20:56492246-56492268 TTTTGTATTTTTTATAGAAACGG + Intronic
1175343921 20:58256552-58256574 TTTAGTACCTTTTGTAGTTCAGG - Intergenic
1176262835 20:64191806-64191828 TTTGGTATCTTGTTTATTAGGGG + Intronic
1176427259 21:6556332-6556354 TTTAGTATTTTTAATAGAAATGG + Intergenic
1176596426 21:8702057-8702079 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1176657259 21:9598288-9598310 TTTTGTATCTTTTATAGAGATGG + Intergenic
1176898284 21:14409147-14409169 TTTAATAGTTTTTATTGTAGAGG + Intergenic
1176997626 21:15575595-15575617 TTTTCTCTCTTATATAGTAGAGG - Intergenic
1177049293 21:16211698-16211720 TTTATTAGCTTATACAGTAGAGG + Intergenic
1177874549 21:26615406-26615428 TTTTGTATCTTTTGTAGAGGGGG - Intergenic
1177984510 21:27957153-27957175 TTTAATAACTTTAATAGTGGAGG - Intergenic
1178086859 21:29120893-29120915 TTTTGTATTTTTTGTAGAAGTGG - Intronic
1178476571 21:32942504-32942526 TTTTGTATTTTTTATAGAAACGG - Intergenic
1178544637 21:33482406-33482428 TTAAGTTGCTTTTTTAGTAGTGG + Intergenic
1179702750 21:43164649-43164671 TTTAGTATTTTTAATAGAAATGG + Intergenic
1180279339 22:10679506-10679528 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1180295911 22:10935379-10935401 TGAAGTATCTTTTGTACTAGAGG - Intergenic
1180586551 22:16898038-16898060 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1180681112 22:17627649-17627671 TTTTGTATTTTTTTTAGTAGAGG - Intronic
1181012590 22:20051029-20051051 TTTTGTATCTTTAATAGAAATGG + Intronic
1181331089 22:22091756-22091778 TTTTGTATTTTTTATAGAAATGG - Intergenic
1181929353 22:26387460-26387482 TTTAGTATTTTTTGTAGAAATGG + Intergenic
1182630405 22:31680788-31680810 TTTTGTATTTTTTTTAGAAGAGG - Intronic
1182724812 22:32436121-32436143 TTTTGTATTTTTTATAGAAACGG - Intronic
1183198850 22:36372160-36372182 TTTAGTAGCTGTTATATTGGAGG - Intronic
1183569118 22:38639066-38639088 TTTAATATATTTTATAGATGAGG - Intronic
1183925127 22:41200299-41200321 TTTTGTACTTTTTTTAGTAGAGG - Intergenic
1184082668 22:42234969-42234991 TCTTGTATTTTTTTTAGTAGAGG - Intronic
1184627710 22:45750261-45750283 TTTTGTATTTTTTTTTGTAGAGG + Intronic
1184971140 22:48021018-48021040 TTTATTATCTTATATACTTGAGG - Intergenic
949340019 3:3019460-3019482 TTTTGTATTTTTTTTAGTAAAGG + Intronic
949619953 3:5799667-5799689 TTTAGTGTGTTTTATCTTAGAGG + Intergenic
950825420 3:15814070-15814092 TGTAGAAACATTTATAGTAGTGG - Intronic
951087025 3:18524586-18524608 TTTAATTTCTTTAATAGTGGAGG + Intergenic
951102809 3:18709102-18709124 CTTAGTGTTTTTTGTAGTAGGGG + Intergenic
951179520 3:19642840-19642862 TTTAGTATTGTTTATAAGAGTGG - Intergenic
951245452 3:20336134-20336156 TTTAGTATCAGTGATAGGAGAGG - Intergenic
952143463 3:30504901-30504923 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
952377259 3:32778186-32778208 TTTTGTATTTTTTGTAGAAGCGG + Intergenic
952470206 3:33640062-33640084 TTTAGTATCTTCTTCAGTAAGGG + Intronic
952583920 3:34868389-34868411 TTTAGCATATTTTATAACAGTGG + Intergenic
952824340 3:37512519-37512541 TTTATTTTTTTTTAAAGTAGAGG + Intronic
953507367 3:43499254-43499276 TTTACAATCTTTTACAGTTGAGG + Intronic
953672213 3:44972756-44972778 TTTAGAATTTATTATAGTGGGGG - Intronic
954310739 3:49765026-49765048 TTTAGGATCTTTTGTACTTGAGG - Intronic
954350547 3:50039612-50039634 TTTTGTATCTTTTAGAGCAATGG - Intronic
954741319 3:52753129-52753151 TTTGGTATTTTTTATAGAAATGG - Intronic
955328628 3:58028781-58028803 TTTTGTATTTTTTTTAGTGGAGG + Intronic
955545474 3:60024198-60024220 ATTAGTATCTGTCATAGAAGAGG - Intronic
955764658 3:62329365-62329387 TTTAATAACTTTTACTGTAGAGG - Intronic
956106993 3:65829760-65829782 TTTAATATCTTTGAGAGTAATGG - Intronic
956222026 3:66914675-66914697 TTTAGTATTTCTTGTAGGAGAGG - Intergenic
956536385 3:70281497-70281519 TAAAGTCTCTTTAATAGTAGTGG + Intergenic
957547255 3:81655685-81655707 TTCTGTATTTTTTTTAGTAGAGG + Intronic
957610275 3:82456670-82456692 TCTAGAATCTTTTAGGGTAGTGG + Intergenic
958087458 3:88829050-88829072 TTTAGTTTCTTTTATAAGAGTGG + Intergenic
958259434 3:91363106-91363128 TTTAGTATTTTCTTTAGTATGGG - Intergenic
958599799 3:96281091-96281113 TTTGCTATCTGTTATAGCAGTGG + Intergenic
959280081 3:104326187-104326209 TTTAGCAGTTTTTATAGTGGTGG - Intergenic
959562586 3:107799543-107799565 TCTAGTATCTTTAAAAGTATAGG - Intronic
961928605 3:130509788-130509810 TTAAGTATCTTTTACAGATGAGG - Intergenic
962165878 3:133047325-133047347 TTTAGTTACTTTTAAAATAGAGG - Intronic
963095512 3:141534853-141534875 TTTAATATCTCTTATATTAATGG - Intronic
963657189 3:148069630-148069652 TATAGAATATTTTATAGAAGTGG + Intergenic
963669604 3:148235226-148235248 TTTTGTATCTTTTTTAGAGGTGG - Intergenic
963763111 3:149305696-149305718 TTTAGTATTTCTTATAGGAAAGG + Intergenic
964532589 3:157684375-157684397 TTTAGTTTCTTTTGTTGTTGTGG + Intergenic
964632137 3:158822839-158822861 TTTAGTATCCTTGCTAGTATTGG + Intronic
965145415 3:164895393-164895415 TTACGTATGTTTTAAAGTAGGGG - Intergenic
965357458 3:167693999-167694021 TTTAGTATGCTTTATATTATGGG + Intronic
965401421 3:168217491-168217513 ATTAGTATATTTTATACAAGAGG - Intergenic
965450547 3:168832954-168832976 TTTAGTATTTCATATAGTGGTGG - Intergenic
965566428 3:170123619-170123641 TTTTGTATTTTTTTAAGTAGAGG - Intronic
965975992 3:174622869-174622891 TTTTGTACTTTTTTTAGTAGAGG - Intronic
967094187 3:186163174-186163196 TTTAAAATCTTTTGTAGAAGGGG + Intronic
967492676 3:190111647-190111669 TTTAAAATCTTTTATTCTAGAGG - Intronic
968028903 3:195466070-195466092 TTTAGTATTTTTTGTAGAGGTGG - Intergenic
968537212 4:1140920-1140942 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
970329291 4:14962603-14962625 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
970671661 4:18403653-18403675 TGTAGTATCTTTTCTGGTAAGGG + Intergenic
971589426 4:28448165-28448187 TTAAGAATTTTTTATATTAGAGG + Intergenic
971718934 4:30219403-30219425 TTTAGCATTTCTTATAGGAGAGG + Intergenic
972029361 4:34433494-34433516 TTCCGTATTCTTTATAGTAGGGG - Intergenic
972127482 4:35787886-35787908 CATAGTATTTTTCATAGTAGTGG - Intergenic
972145179 4:36015204-36015226 TTGAATATCTTTTATATCAGAGG - Intronic
972902545 4:43702287-43702309 TTTAGTATTTCTTATAGGACAGG + Intergenic
973896480 4:55418872-55418894 TTTTGTATTTTTAGTAGTAGGGG - Intronic
974210570 4:58769152-58769174 TTTAATATGTTTTATAATAATGG + Intergenic
974366289 4:60953883-60953905 TTTATTTTCTTTTGTAGTAATGG + Intergenic
974821433 4:67071155-67071177 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
974875088 4:67694043-67694065 TTTTGTATTTTTTTTAGTAGAGG - Intronic
975846608 4:78531916-78531938 TTTAATATATTTTAAAGGAGAGG - Intronic
976089505 4:81441711-81441733 TTTTGTATTTTTTATAGAGGTGG + Intronic
976171416 4:82308797-82308819 TTTAGCATTTTTTATAGGAAAGG + Intergenic
976352923 4:84081042-84081064 TTAATTATCTTTTATAGTTAGGG - Intergenic
976402922 4:84627783-84627805 CTGAGTATCTTTTATATCAGAGG + Intronic
976437214 4:85032054-85032076 TTTTGTATTTCTTTTAGTAGAGG + Intergenic
976896417 4:90117442-90117464 TTCAGTATCTTTTATATCAGTGG + Intergenic
977008534 4:91604523-91604545 TTTTATATTTTTTAAAGTAGAGG + Intergenic
977555561 4:98484630-98484652 TATAGTTTCATTTATAGTGGTGG - Intronic
977959265 4:103067082-103067104 TTTATTATGTTTTATAATACTGG + Intronic
978057497 4:104290496-104290518 TTTGGTATATTTTATAGAAGTGG - Intergenic
978086872 4:104665655-104665677 TTTAGTGGGTTTTATATTAGGGG - Intergenic
978791703 4:112669689-112669711 TTTAGTATTTTGTAGAGAAGGGG + Intergenic
979293464 4:119003688-119003710 TTTAGTATCTTTTATAGTAGAGG + Intronic
979504088 4:121475055-121475077 TGTAGTATCTATGACAGTAGAGG + Intergenic
979604738 4:122625835-122625857 TTTAGTATGTATAATAGTAGTGG - Intergenic
979757074 4:124354377-124354399 TTTTGTATTTTTTATAGAAATGG - Intergenic
980153474 4:129077760-129077782 TTTAGTATGTTTTGCAGTAAAGG - Intronic
980413184 4:132449131-132449153 TTTAGTATTTCTTATAGGATGGG - Intergenic
981667969 4:147251897-147251919 TCTAGTATTTTTTATAGCACAGG - Intergenic
981951524 4:150414659-150414681 TTTTGTATTTTTAATAGCAGTGG + Intronic
982018737 4:151182157-151182179 TTTCGTATCTTTTGTAGAAACGG + Intronic
982516871 4:156363601-156363623 TATATTATCTTTTAGAGCAGAGG + Intergenic
982563494 4:156960383-156960405 TCTAGTCTCTTGTATTGTAGAGG - Intronic
982599743 4:157432646-157432668 TTTGGTCTCTTTTATAAAAGAGG + Intergenic
982622957 4:157729458-157729480 TTTAGCATTTTTTATAGAAAAGG - Intergenic
983111149 4:163750805-163750827 TTTATTATCTTCTACATTAGTGG - Intronic
983175525 4:164584174-164584196 TTTAGCAGTTCTTATAGTAGTGG + Intergenic
983458323 4:167993684-167993706 TTTAATAGTTTTTATTGTAGAGG + Intergenic
983601752 4:169537600-169537622 TTTGCTATCTTTTATACCAGGGG - Intronic
983987887 4:174082268-174082290 TTTTGTATCTTTTATAGAGATGG + Intergenic
984573779 4:181423794-181423816 TTTTGTATTTTTTATAGAGGTGG - Intergenic
985418166 4:189757841-189757863 TTTTGTATCTTTTATAGAGATGG - Intergenic
986801100 5:11261147-11261169 TTTAGTTTTTGTTAGAGTAGAGG - Intronic
986858407 5:11899386-11899408 GTTAGAATCTTTTATAATAATGG + Intronic
987018036 5:13840306-13840328 TCTAATTTATTTTATAGTAGAGG + Intronic
987503555 5:18743585-18743607 TTTACTGACTTGTATAGTAGAGG - Intergenic
987548300 5:19342829-19342851 TTTAAGATCTTTAATGGTAGTGG + Intergenic
987993132 5:25241400-25241422 TTTACTATCATATATATTAGTGG - Intergenic
988453148 5:31363351-31363373 GTTATTTGCTTTTATAGTAGAGG - Intergenic
989599730 5:43190141-43190163 TTCAGTATCTTTCACAGCAGGGG - Intronic
989969351 5:50503948-50503970 GTTAGTATTTTTTATAGTTTTGG + Intergenic
990052001 5:51513914-51513936 TTTAATGTCTTTCATAGTGGAGG + Intergenic
990415478 5:55581893-55581915 TTTTGTATTTTTTGTAGAAGTGG - Intergenic
990820637 5:59836009-59836031 TTTAGCATATTTTATAGATGAGG - Intronic
991197637 5:63955089-63955111 ATTAATTTCTTTTTTAGTAGGGG - Intergenic
993011425 5:82487918-82487940 TTTTGTATATTTTTTTGTAGAGG + Intergenic
994057842 5:95439698-95439720 TTTACTTTTTTTTAAAGTAGTGG - Intronic
994464559 5:100110332-100110354 TTTATAATCTTTCCTAGTAGTGG - Intergenic
994883450 5:105528194-105528216 TTTAGCATTTCTTATAGTGGTGG + Intergenic
995384296 5:111571774-111571796 TTTAGTATGTTTAGTATTAGAGG + Intergenic
996029693 5:118691498-118691520 TTTAGCATCTTTTATAATTAAGG - Intergenic
996181939 5:120430503-120430525 CTCAGTATGTTTTATTGTAGTGG + Intergenic
996409253 5:123139303-123139325 TTTATTATTTCTTAAAGTAGAGG + Intronic
996713686 5:126568759-126568781 TTTAGTATTTTTTATAGAGATGG - Intronic
997447818 5:133954310-133954332 TTTATTTTATTTTTTAGTAGAGG - Intergenic
997495968 5:134326129-134326151 TTTAGTGTCTCTTTTGGTAGTGG - Intronic
997536725 5:134628206-134628228 TTTTGTATTTTTTATAGAAATGG - Intronic
998009752 5:138685008-138685030 TTTTGTATTTTTTATAGAGGTGG + Intronic
998045153 5:138981032-138981054 TTTTGTATCTTTTATAGAAATGG - Intronic
998292717 5:140930254-140930276 TTTAATTTCTTTTATTTTAGGGG + Intronic
999969950 5:156849506-156849528 TTTAGCATTTTTTATAGGATGGG - Intergenic
1000644250 5:163741629-163741651 TTTTGTATTTTTAATAGAAGCGG - Intergenic
1002123061 5:177020759-177020781 TAAAGTATTTTTTATTGTAGTGG - Intronic
1002410653 5:179073266-179073288 TTTAGTGTATCTTATAGTACAGG - Intronic
1003973990 6:11325681-11325703 TTTAGTACCTTTCACAGCAGAGG + Intronic
1004803443 6:19176458-19176480 TTTTGTATTTTTTATAGAAATGG - Intergenic
1005465035 6:26104634-26104656 TTTTGTATTTTTTTTGGTAGAGG - Intergenic
1005616092 6:27574752-27574774 TTTTGTATTTTTTGAAGTAGTGG - Intergenic
1006539338 6:34726834-34726856 TTTTGTATTTTTTATAGAAACGG + Intergenic
1008101280 6:47393801-47393823 TTTTGTATTTTTTATAGAGGCGG - Intergenic
1008279987 6:49585501-49585523 TTTAGTATCTTTAGTAGAGGTGG + Intergenic
1008367919 6:50704377-50704399 TTCAGTATGTTTTTTAGTAAAGG + Intergenic
1008995802 6:57657218-57657240 TTTAGTATTTTCTTTAGTATGGG + Intergenic
1009184330 6:60555998-60556020 TTTAGTATTTTCTTTAGTATGGG + Intergenic
1009621727 6:66085890-66085912 TTTATTATCTCTTATAATACAGG + Intergenic
1009768705 6:68117502-68117524 TTTAGTATCTATGATACTATAGG - Intergenic
1011210360 6:84949559-84949581 TTTAGTATTTCTTATAGTTCTGG + Intergenic
1011589400 6:88956866-88956888 TTTTGTATTTTTAATAGAAGCGG - Intronic
1012103462 6:95122408-95122430 TTCAGTATCATTTATATTATTGG - Intergenic
1012381313 6:98622947-98622969 TTTTGTATTTTTTATAGAAATGG + Intergenic
1013243676 6:108268763-108268785 TTTTGTATTTTTGTTAGTAGAGG + Intergenic
1013262327 6:108457755-108457777 TTTAACATTTCTTATAGTAGTGG + Intronic
1013478795 6:110534518-110534540 TTTATTATCTTTTTTAATATTGG - Intergenic
1013685912 6:112582200-112582222 TTTAATATCACTTATAATAGAGG - Intergenic
1013687025 6:112597211-112597233 TTAATTATATTTTTTAGTAGTGG - Intergenic
1014129933 6:117819285-117819307 TTTAGTATTTCTTAAAGTAAGGG + Intergenic
1014516347 6:122383520-122383542 TTTTGTAATTTTTATTGTAGAGG + Intergenic
1014618225 6:123631457-123631479 TTTAATATCTATTATAATATGGG - Intronic
1015248661 6:131104018-131104040 TCTGGTATCTTTTCTAGTAAGGG - Intergenic
1015283563 6:131459575-131459597 TTTAATTTTTTTTTTAGTAGAGG - Intergenic
1015457600 6:133445436-133445458 TTTAGTATTTGTTATAGTTCAGG + Intronic
1016350750 6:143164573-143164595 TTTAGGAGATTTTATAGCAGTGG + Intronic
1016953472 6:149604106-149604128 TTTATTTTCTTTTAGAGCAGTGG - Intronic
1016961102 6:149673619-149673641 TTTAGGATTTTTTATAGTATAGG - Intronic
1017142853 6:151207429-151207451 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1017298470 6:152827948-152827970 TTTTGTATTTTTTATAGATGAGG - Intergenic
1017350372 6:153433965-153433987 TTTCATATCTTTTATAAAAGGGG - Intergenic
1017680445 6:156858596-156858618 TTTTGTATACTTTTTAGTAGAGG - Intronic
1018297663 6:162366733-162366755 TTTTGTATTTTTTATAGAGGCGG - Intronic
1019650250 7:2153068-2153090 TTTAGTATTTTTTATATTTTTGG - Intronic
1020283191 7:6661752-6661774 TTTTGTATCTTTTGTAGTGATGG + Intergenic
1020686046 7:11297029-11297051 TTTTGTATTTTTTATAGAGGTGG + Intergenic
1020695463 7:11408325-11408347 TTTTATATTTTTTTTAGTAGAGG - Intronic
1020809090 7:12829564-12829586 TTTAGTATCTATAATACTATGGG - Intergenic
1021105696 7:16637244-16637266 TTTATGTTCTTTTATAGGAGAGG - Intronic
1021192639 7:17639574-17639596 TTTAATATAATTAATAGTAGGGG - Intergenic
1021475295 7:21054286-21054308 TTTAGTATCCCTTGTAGGAGAGG - Intergenic
1021589879 7:22249355-22249377 TTTTGTATTTTTTTTGGTAGAGG + Intronic
1022733170 7:33051048-33051070 TTTATTCTCTTTTAAATTAGAGG - Intronic
1022748451 7:33197922-33197944 TTTAGTATCTTTGAAGGTTGAGG - Intronic
1023069017 7:36409840-36409862 TTTAGTATTTTTTATAGAGATGG + Intronic
1023434125 7:40124833-40124855 TTTAGTATTTTTTATAGAGATGG - Intergenic
1023679869 7:42674556-42674578 TTTAGTAGCTTTTAAAGAATAGG - Intergenic
1026618087 7:71925420-71925442 TTCACTATTTTTTATAGTAAAGG + Intronic
1026954090 7:74365922-74365944 TTTTGTATTTTTTTTTGTAGAGG + Intronic
1027169755 7:75863323-75863345 TTTTGTATTTTTAATAGTAACGG + Intronic
1027195589 7:76027931-76027953 TTTTGTATTTTTTATAGAAATGG - Intronic
1027966419 7:85015873-85015895 TTGAGTATCTGTGGTAGTAGCGG + Intronic
1028176600 7:87667519-87667541 ATTACTATTTTTAATAGTAGTGG + Intronic
1028193979 7:87883746-87883768 TTTATTATCATTTATAGTGTGGG + Intronic
1028320695 7:89456264-89456286 TGTTGTACCTTTTTTAGTAGTGG - Intergenic
1028835804 7:95373803-95373825 TTCATTATCTTCTAGAGTAGGGG + Intronic
1030274608 7:107706995-107707017 TTTTGTATTTTTTGTAGTAACGG - Intronic
1030824305 7:114136205-114136227 TGTAGGATATTTTAGAGTAGAGG - Intronic
1031190839 7:118548431-118548453 TTTAGAATATTTTATAATGGAGG + Intergenic
1031407414 7:121403323-121403345 TTTAGTATAGTTTTTAGTATTGG + Intergenic
1031543059 7:123018827-123018849 TTTAGTATTTTTCATCATAGTGG + Intergenic
1031698189 7:124887285-124887307 TTTAATATCTGTTGTTGTAGAGG - Intronic
1031708552 7:125013997-125014019 TTTAGTGTTTTTTATTGTTGTGG - Intergenic
1031834897 7:126670801-126670823 TTTAGTTTTTTTTATAGTCAAGG + Intronic
1032434975 7:131893189-131893211 TTTTGTATTTTTTAAAGTAGGGG + Intergenic
1033090087 7:138377839-138377861 TTAAGTATATTTTAAAGTGGAGG - Intergenic
1033947083 7:146733065-146733087 ATTAATATCTTTTCTATTAGTGG - Intronic
1033976459 7:147108537-147108559 TATAGTAACTTGTATAGTAGAGG - Intronic
1034141011 7:148816397-148816419 TTTAGTAGCTTTTGCAGTAAAGG - Intronic
1034947909 7:155275682-155275704 TTTTGTATCCTTTATAGTGACGG - Intergenic
1037197033 8:16203262-16203284 TTTATTTTGTTTTACAGTAGTGG + Intronic
1037845986 8:22282759-22282781 TTTTGTATTTTTTATAGTGCGGG + Intronic
1037866456 8:22447486-22447508 TTTGGTATTTTTTATAGAGGTGG + Intronic
1038240451 8:25803232-25803254 TTTAGTATTTTTTATAGAGATGG + Intergenic
1038490942 8:27970661-27970683 GTTAGTAACTTTTATTGAAGTGG - Intronic
1039617848 8:38970627-38970649 TTTTGCATATTTTTTAGTAGAGG - Exonic
1039980828 8:42408691-42408713 TTTTGTATTTTTTTTTGTAGAGG + Intergenic
1040869424 8:52084911-52084933 TTTAATACTTTTTAAAGTAGAGG + Intergenic
1041793181 8:61718027-61718049 CTTAGTATCTTTTAAATTAAAGG + Intergenic
1042028452 8:64448502-64448524 TTTTGTATATTTTTTAGTAGAGG - Intergenic
1042131553 8:65591617-65591639 TTTTGTATTTTTTATAGTTACGG - Intergenic
1042739161 8:72024357-72024379 TTTAGTATCTTTTAAACCATAGG + Intronic
1043006100 8:74820575-74820597 TTCAGTTTCTTTTATAGGAAGGG + Intronic
1043059387 8:75480879-75480901 TTTTGTATTTTTTATTTTAGCGG + Intronic
1043101330 8:76051002-76051024 TTTTGTTTTTTTTAAAGTAGAGG - Intergenic
1043108224 8:76142499-76142521 TTTAGTATATGTTGTAGTACAGG - Intergenic
1043143275 8:76618058-76618080 TTTAGTTTCTTTTAGAGATGGGG - Intergenic
1043455458 8:80407896-80407918 TTTTGTATTTTTTTTGGTAGCGG - Intergenic
1043547743 8:81334361-81334383 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1043654917 8:82651185-82651207 TATAGTACATATTATAGTAGAGG + Intergenic
1043845974 8:85164466-85164488 TTTGATATCTTTTATAGCAGGGG - Intergenic
1044086411 8:87947205-87947227 TTTAGTATCTTTAGTAGACGTGG - Intergenic
1044419879 8:91982072-91982094 TTTTGTATTTTTTGTAGGAGTGG - Intronic
1044553359 8:93536128-93536150 TTTAGTATCCTTCATAATAAGGG - Intergenic
1045127519 8:99108683-99108705 TTTAGTATATTTTAAAGTCAGGG + Intronic
1045899312 8:107257025-107257047 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1045996089 8:108363875-108363897 TTTTGTATTTTTTGTAGAAGTGG + Intronic
1046012657 8:108569223-108569245 TTTTGTATTTTTTTTAGTAGAGG - Intergenic
1046646728 8:116793730-116793752 TTTTGTATTTTTTATAGAAACGG + Intronic
1047226266 8:122957636-122957658 TTTTCTATTTTTTTTAGTAGAGG + Intronic
1047261416 8:123264379-123264401 TTTAGACTTTTTTTTAGTAGTGG - Intronic
1047547606 8:125834505-125834527 TTTTGTATTTTTTGTAGGAGTGG + Intergenic
1048393032 8:133986112-133986134 TTTTGTATTTTTTATAGAAATGG - Intergenic
1048663981 8:136640568-136640590 TTTGATATCTTTTATAGTAGGGG - Intergenic
1049923514 9:387270-387292 TTTTGTATCTTTAGTAGGAGGGG - Intronic
1049927894 9:427289-427311 TTTAGTATCTAGAACAGTAGTGG + Intronic
1051063850 9:13077518-13077540 TTTTTTATCTTTTATAGCAGGGG - Intergenic
1051084539 9:13333061-13333083 TTTTGTATCTCTTATACTATTGG - Intergenic
1051646864 9:19277685-19277707 TTTAGTATGTTGAATAGCAGTGG + Intronic
1051648068 9:19290547-19290569 TTTAGTTTCTGTTATAGCAAGGG + Intronic
1051661377 9:19430223-19430245 TTTACTACCCTTTAAAGTAGTGG - Intronic
1052066588 9:24029233-24029255 TTTCTTATCTTTTATAGTAGAGG + Intergenic
1053475094 9:38377001-38377023 TTCAGTCTCTTTTCTAGTATTGG - Intergenic
1053695467 9:40635632-40635654 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1053942460 9:43266680-43266702 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1054306713 9:63434856-63434878 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1054405451 9:64758846-64758868 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1054439075 9:65244335-65244357 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1054491331 9:65777606-65777628 TTTTGTATTTTTTTTAGTGGAGG - Intergenic
1054902157 9:70380631-70380653 TTTAATATATTTTATAAGAGTGG - Intergenic
1055159903 9:73113734-73113756 TTTTGTATTTTTTTTTGTAGAGG + Intergenic
1055673004 9:78626066-78626088 TTAAGTATCTTGTGTAGTATAGG - Intergenic
1055683117 9:78739319-78739341 TTTAGCATTTCTTATAGTATAGG + Intergenic
1055879062 9:80977059-80977081 TTTTGTATCTTTAGTAGAAGTGG - Intergenic
1055963924 9:81846663-81846685 TTTTGTATTTTTAGTAGTAGTGG + Intergenic
1056828938 9:89898708-89898730 TGTATTATCTTTTATAATATTGG + Intergenic
1057026683 9:91739334-91739356 TTTTGTATTTTTTATAGAGGTGG - Intronic
1057110915 9:92469997-92470019 TTTTGTATTTTTTATAGAGGTGG + Intronic
1057180822 9:93029206-93029228 TTTTGTATATTTTTTAGTAGAGG + Intronic
1057452097 9:95173743-95173765 TTTTGTATTTTTTATAGAGGTGG - Intronic
1057561561 9:96131773-96131795 TTTTGTATTTTTTATAGAGGTGG - Intergenic
1057600543 9:96453235-96453257 TTTTGTATATTTTTTAGTAGAGG + Intronic
1058768655 9:108208718-108208740 TTTTGTATTTTTTTTAATAGAGG + Intergenic
1059253638 9:112909365-112909387 TGGAGTATCTGTTATAGAAGAGG + Intergenic
1060285666 9:122249537-122249559 TTTTGTATTTTTTGTAGAAGCGG - Intronic
1060655833 9:125372036-125372058 TTTTGTATTTTTTATAGGTGGGG + Intergenic
1061115291 9:128606651-128606673 TTTTGTATTTTTTTTAGTAGAGG + Intronic
1061308879 9:129749473-129749495 TTTTGTATTTTTTATAGAGGGGG - Intronic
1061847939 9:133398352-133398374 TCTAGTATCATTCATAATAGTGG - Intronic
1062593682 9:137287773-137287795 TTTTGTATTTTTTATAGAAATGG + Intergenic
1202777911 9_KI270717v1_random:9248-9270 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1203634981 Un_KI270750v1:101862-101884 TTTTGTATCTTTTATAGAGATGG + Intergenic
1186098562 X:6130056-6130078 TTTAGTCTTTTTTATAGAGGTGG + Intronic
1186834224 X:13421323-13421345 TTTTTTATATTTTTTAGTAGAGG - Intergenic
1187169331 X:16836085-16836107 TTTTGTATCTTTTATAGAGATGG - Intronic
1187174957 X:16887979-16888001 TTTTGTATTTTTTATAGTGATGG + Intergenic
1187345593 X:18460669-18460691 TTTTGTATTTTTTGTAGAAGCGG + Intronic
1187605011 X:20873675-20873697 TTTAATATTTCTTATAGTACAGG + Intergenic
1187937343 X:24348734-24348756 TTTTGTATTTTTTATAGAAACGG - Intergenic
1188146613 X:26621711-26621733 TTATGTATTTTTTTTAGTAGAGG - Intergenic
1188773138 X:34179261-34179283 TCTAGTTTATTTTATAGTATAGG + Intergenic
1189123450 X:38420235-38420257 ATTATTATCATTTATAGTTGAGG - Intronic
1189463713 X:41262483-41262505 TTTTGTATTTTTTATAGAGGTGG + Intergenic
1189468237 X:41294207-41294229 TTTTATATATTTTTTAGTAGAGG - Intergenic
1190236765 X:48622193-48622215 TTTTGTATTTTTTTTAGTAGAGG + Intergenic
1190570316 X:51775079-51775101 TTTACCATCTATTATAGTAAAGG - Intergenic
1191142409 X:57130604-57130626 TTTAGTGTCTTTTAAACTAGTGG + Intergenic
1193163359 X:78255104-78255126 TTTAGTATTTCTTATAGGATAGG + Intergenic
1193289806 X:79759082-79759104 ATTACTATGTTTAATAGTAGTGG + Intergenic
1194196543 X:90901480-90901502 TTTAGCATTTTTTATAGGACTGG + Intergenic
1194246869 X:91524861-91524883 TTAATTATATTTTAAAGTAGAGG + Intergenic
1194381272 X:93194106-93194128 TTTAGCATTTTTTATAGTGCTGG - Intergenic
1194730686 X:97450401-97450423 GTTAGTTTCTTTTAAAGTATAGG + Intronic
1195566106 X:106340630-106340652 TTTACAATCTATTATAGTAAAGG + Intergenic
1196534574 X:116827796-116827818 TTTAGAATATTTTAAACTAGAGG - Intergenic
1196845445 X:119893401-119893423 AATAGTATTATTTATAGTAGTGG - Intergenic
1196923761 X:120611347-120611369 TTTAGTATCATTTAAATTGGGGG + Intronic
1197100889 X:122653379-122653401 TTTAGCATTTCTTATAGGAGAGG - Intergenic
1197259480 X:124302535-124302557 TTTAGTATTTCTTATAGGACAGG + Intronic
1197457429 X:126695057-126695079 TTTAGTATCTTTTTTACTAATGG - Intergenic
1198253105 X:134901265-134901287 ATAAGTATCTATTATAATAGAGG - Intronic
1198293930 X:135265689-135265711 TTTAGTATTTCCTGTAGTAGAGG - Intronic
1198982154 X:142410353-142410375 TTCAGTATTTCTTGTAGTAGGGG - Intergenic
1199627120 X:149750845-149750867 TTTTTTATATTTTTTAGTAGAGG - Intergenic
1200313198 X:155101067-155101089 TTTTGTATTTTTTATAGAGGTGG + Intronic
1200542389 Y:4475680-4475702 TTTAGCATTTTTTATAGGACTGG + Intergenic
1201193249 Y:11467531-11467553 TTTTGTATTTTTTTTAGTGGAGG + Intergenic
1201407975 Y:13667496-13667518 TTTAGAATCCATTATAGTAAAGG + Intergenic
1201575783 Y:15460109-15460131 TTTTGTATATTTGTTAGTAGAGG + Intergenic
1202113364 Y:21447502-21447524 TTTTGTATTTTTTTTTGTAGTGG + Intergenic