ID: 979296245

View in Genome Browser
Species Human (GRCh38)
Location 4:119035331-119035353
Sequence CTGCCCTCCTAGAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979296245_979296248 4 Left 979296245 4:119035331-119035353 CCCTCAGTCTTCTAGGAGGGCAG 0: 1
1: 0
2: 5
3: 41
4: 227
Right 979296248 4:119035358-119035380 AATCCCAGAACTGGTAAGATTGG 0: 1
1: 0
2: 3
3: 17
4: 167
979296245_979296247 -5 Left 979296245 4:119035331-119035353 CCCTCAGTCTTCTAGGAGGGCAG 0: 1
1: 0
2: 5
3: 41
4: 227
Right 979296247 4:119035349-119035371 GGCAGAGTGAATCCCAGAACTGG 0: 1
1: 1
2: 1
3: 15
4: 196
979296245_979296249 5 Left 979296245 4:119035331-119035353 CCCTCAGTCTTCTAGGAGGGCAG 0: 1
1: 0
2: 5
3: 41
4: 227
Right 979296249 4:119035359-119035381 ATCCCAGAACTGGTAAGATTGGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979296245 Original CRISPR CTGCCCTCCTAGAAGACTGA GGG (reversed) Intronic
900808891 1:4786215-4786237 CTGCCCTCCTTGCACACAGAAGG + Exonic
902980480 1:20119280-20119302 CTACCATGCTAGGAGACTGACGG + Intronic
904122961 1:28214617-28214639 GTTCCCTCCTAGAAGACAGGGGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
914428828 1:147601130-147601152 CTGTCCTCCAAGAGGTCTGAAGG + Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918204795 1:182299265-182299287 CTGCCCTCATATAAGGGTGATGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920102388 1:203525494-203525516 CTGCCCTCCCACCAGGCTGAAGG - Intergenic
920275977 1:204804550-204804572 CTGACCTCCCAGAACACTCATGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922325706 1:224526358-224526380 GTGCCCTCGTAAAAGACTGAAGG + Intronic
923035679 1:230283562-230283584 CTGCCATCTGAGAAGACTAAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064030697 10:11880785-11880807 CAGCTCTCCTAGAACTCTGATGG + Intergenic
1064270233 10:13858902-13858924 CTTCCCTCTTAGATGACGGAGGG - Exonic
1065401795 10:25311950-25311972 CTGGCCTAATAGAAGACAGATGG + Intronic
1065819414 10:29511265-29511287 CTGCCCCCTTAGAAGAATGGAGG - Intronic
1065953433 10:30673149-30673171 CTGCCCCCTTAGAAGAATGGAGG + Intergenic
1066439621 10:35425904-35425926 CTGCCCTCCTAGAAGAGAATTGG - Intronic
1067849677 10:49746778-49746800 CTGCCCTCCTACACGACCAATGG - Exonic
1069562312 10:69439467-69439489 CTGCCCTCCTGAATGACAGATGG + Intergenic
1069938002 10:71932331-71932353 CAACCCTCATAGATGACTGAGGG - Intergenic
1074228436 10:111510576-111510598 TTGCCCTCCAACAAGAATGAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078768168 11:14319662-14319684 CTGTGCTCTTAGAAGACAGAGGG - Intronic
1080653946 11:34243922-34243944 CTGCTCTTCTAGAGTACTGAGGG - Intronic
1081556994 11:44173449-44173471 CAGCCATCCTAAAAAACTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085012293 11:73149646-73149668 CTCCCCTCCTAGAATACTACAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089678355 11:120105582-120105604 CTGCCCCCCAGGAAGTCTGATGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090761328 11:129839203-129839225 CTGGCCACCAAGAAGACTGGAGG - Intronic
1091252601 11:134156173-134156195 CTGCCCTCCCAGAAGTCTCCGGG + Intronic
1091383804 12:79137-79159 CTGCTCTCCGAGAACACAGAGGG + Intronic
1092769688 12:11885288-11885310 CTGCCTTCTTAGAAGGCTGCAGG - Intronic
1092828067 12:12415832-12415854 CTGCCCTCATAGATGAGTTAGGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093380466 12:18485213-18485235 CTGTCCTGCTGGTAGACTGATGG + Intronic
1094391921 12:29960942-29960964 CTGCCCTCATAGCTGAATGACGG - Intergenic
1095110424 12:38288885-38288907 GCCCCATCCTAGAAGACTGAAGG - Intergenic
1095180157 12:39138012-39138034 CTGCCCTACTAGCAAGCTGAGGG - Intergenic
1096470638 12:51873506-51873528 CTGCACTCCTAGTGGACTGGAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1099717822 12:86319048-86319070 CTACCCTTCTACAAGACTCAGGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101532071 12:105582355-105582377 GTTCACTCCTAGAAGCCTGAGGG - Intergenic
1101867309 12:108529774-108529796 CTGCCCCCTTACAAGACTGCAGG + Intronic
1103610791 12:122123075-122123097 CTCCTCTCCTTGAAGATTGACGG + Intronic
1105412645 13:20184244-20184266 GTGTCCTCCTAGAAGGCAGATGG - Intergenic
1106468969 13:30038082-30038104 CTGGCTTCCTAGATGACTAAAGG + Intergenic
1107157063 13:37180706-37180728 TTGCGCTCTGAGAAGACTGAGGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1110786263 13:79530838-79530860 CAACCCTCATAGATGACTGAGGG - Intronic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1113984429 13:114302570-114302592 CTGGCCTCCTAGCAAACTGAGGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1118200390 14:63666140-63666162 CTGCCCTCTTGGAAGTTTGAAGG - Intergenic
1120203891 14:81567334-81567356 CTGGCCTCCTAACAGATTGAGGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121317707 14:92971935-92971957 CTGCCCTCCTGGGACACTGATGG + Intronic
1124201420 15:27681662-27681684 CTGCGCTCCTAGAAACCTCATGG + Intergenic
1126640861 15:50825368-50825390 ATGCTCTCCTTAAAGACTGAAGG - Intergenic
1127391911 15:58512614-58512636 CTGCCTTCCTAAAAGACTGCTGG - Intronic
1128412975 15:67417507-67417529 TTGCTCTCCTAGAAAACAGAAGG - Intronic
1128418397 15:67467768-67467790 CAGCCCCCTTTGAAGACTGAAGG + Intronic
1130349920 15:83082670-83082692 CTTTCCTCCTATAAGACAGAAGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1132293370 15:100718539-100718561 CTGCCCTCCTTCACGACAGAGGG - Intergenic
1135493065 16:22926475-22926497 GTCCCTTCCTAGAAGCCTGAGGG - Intergenic
1136500194 16:30666277-30666299 CTGCCCTGCTGGAAGGCTGCGGG - Intronic
1137716219 16:50599961-50599983 CCACCCTCCTTGAAGACTCATGG - Intronic
1137719854 16:50621607-50621629 CTGCCTCCTGAGAAGACTGACGG + Exonic
1141409092 16:83820440-83820462 GTGTCCCCCTAAAAGACTGATGG + Intergenic
1141779414 16:86149589-86149611 CTGGTCTCCTAGAATACAGATGG - Intergenic
1142157491 16:88539269-88539291 GTGCCCTCCTGGAAGAAGGAGGG - Intergenic
1142295772 16:89221112-89221134 CTGCCATCCTGGGAGGCTGACGG - Exonic
1143037579 17:4008167-4008189 CTGGCCTCGTAGAAGACAGCTGG - Intronic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1143633307 17:8150933-8150955 CTGGCCTCCTGCAGGACTGATGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146601728 17:34223026-34223048 CAGACCTCCTAGAAGCTTGAAGG - Intergenic
1146902327 17:36596883-36596905 CTGATCTCCAAGAAGGCTGAGGG - Intronic
1148563336 17:48618791-48618813 CTGCTCTCCCAGAAAACTGGTGG - Intronic
1152722422 17:81929464-81929486 CTGTCCTCCTAGAGAGCTGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1159599437 18:70414476-70414498 CTGCTCTCCTAGACAACTAAAGG + Intergenic
1160153000 18:76409380-76409402 CTGACCTCCAAGAACACTGCAGG + Intronic
1160207292 18:76845347-76845369 CTGCCCCCTAAGAAGACAGAGGG - Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160806166 19:993102-993124 CTGGCCTCCTTGCAGTCTGAGGG - Intronic
1162262699 19:9545652-9545674 CTACCTTTCCAGAAGACTGAGGG - Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
925244066 2:2363958-2363980 CTGCACTCCAAGAAGAAAGAGGG - Intergenic
926280160 2:11439738-11439760 CTGGCCTAATAGAAGACAGATGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930524662 2:52512781-52512803 CTCCCCACCCAGAACACTGAGGG + Intergenic
932559125 2:72851697-72851719 CTGCTCTCCCAGAAGACTCGTGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934954411 2:98605473-98605495 CTGCGTTCATGGAAGACTGAGGG + Intronic
937225868 2:120368414-120368436 ATGGCCACCTAGAAGCCTGAGGG + Intergenic
939745518 2:145961475-145961497 CAACCCACCTAGAATACTGAGGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940601790 2:155872586-155872608 CTGCCAACCTAGAACACTGCAGG + Intergenic
940856503 2:158732406-158732428 GTCCCCTACTGGAAGACTGATGG + Intergenic
943204987 2:184883410-184883432 CTGGCCTCATAGAAGAGTTAGGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944121566 2:196246166-196246188 CTGCTCTCCTAGATGAATGAGGG + Intronic
946688386 2:222293485-222293507 CTGTACCCCTAGAAGACAGAGGG + Intronic
946864857 2:224033779-224033801 CTGCCCTCCTTGAGGTCTGTTGG - Intronic
947430661 2:230024769-230024791 CTGACCTCACAGATGACTGAAGG - Intergenic
1169080670 20:2796269-2796291 CTGCCCTCCATGAACCCTGATGG - Exonic
1170535062 20:17332770-17332792 CTGACCTGCTAGAAGGTTGATGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170890471 20:20371102-20371124 CTGCCCTTCTGGCAGCCTGAGGG + Intergenic
1172189609 20:33054028-33054050 CTGCCCTCCCATATGAATGATGG + Intergenic
1172278911 20:33696884-33696906 CTGCCCAGATAGAAGACAGAGGG - Intergenic
1173114555 20:40228381-40228403 CTGCCCATGGAGAAGACTGAGGG - Intergenic
1173383960 20:42571695-42571717 CTGCTATCCAAGAAGGCTGAGGG + Intronic
1173950381 20:46988232-46988254 CAGCCCTCCTGGGATACTGAGGG + Intronic
1174423342 20:50415286-50415308 CTCCCCTCCTTGAAGACTGCTGG + Intergenic
1174991212 20:55512374-55512396 CAGCCCTCATAAATGACTGAGGG - Intergenic
1175761373 20:61564055-61564077 CTGTCCTCACAGGAGACTGAGGG - Intronic
1176024082 20:62977078-62977100 CTGACCTCCTTGGGGACTGAGGG + Intergenic
1176025422 20:62983036-62983058 CTGCCCTCACAGAGGACTGAGGG + Intergenic
1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG + Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179891042 21:44335257-44335279 CTGCCCTCCCAGCAGACTAAGGG - Intronic
1180079500 21:45480315-45480337 CTGCCCCCAGAGAAGCCTGAAGG - Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1181756531 22:25028549-25028571 CTGCCCACCCAGAAGCCTGCGGG + Exonic
1182018248 22:27059433-27059455 ATGGCCTCCTATATGACTGATGG - Intergenic
1182861996 22:33568270-33568292 CTGCCCTCCCGGGAGACTGGTGG - Intronic
1183909712 22:41069274-41069296 CTGCCCACCTCCAAGACTGCTGG + Intergenic
1184857807 22:47156082-47156104 CTGTCCTCCCAGATGGCTGAAGG + Intronic
1185423392 22:50748293-50748315 GTGCCCACCTAGACAACTGAGGG + Intergenic
949689223 3:6615413-6615435 CTGTCCTCCTAGAATACTCATGG - Intergenic
949766654 3:7534433-7534455 TTGCCCTCTTAGAATACTGTAGG + Intronic
950467133 3:13162237-13162259 CTGCCTTCTTGGAAGACAGAGGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951419698 3:22469960-22469982 AAGCCCTCCTTGGAGACTGAGGG + Intergenic
954364786 3:50140005-50140027 GTGCCCTCGTAGAAGCCTCAAGG + Intergenic
954905977 3:54063172-54063194 CTGCCATTCTAGAAAACTTAAGG + Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958856387 3:99391139-99391161 CTGCCCACCCAGTAGAGTGATGG - Intergenic
960037864 3:113119638-113119660 CTGCCCTCAAATCAGACTGATGG - Intergenic
961647380 3:128399876-128399898 CTGCCCTGCTAGCAGGCAGAGGG + Intronic
962091255 3:132246349-132246371 GTGCCCTCCCAGAAGCCTGCTGG - Intronic
963542289 3:146607985-146608007 CTGCCTTCCTAGAAGAACGATGG + Intergenic
963970977 3:151429282-151429304 CTCCCCACCTAGAAGTCGGAGGG + Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965405175 3:168259457-168259479 CAGTCCCCTTAGAAGACTGAAGG - Intergenic
965428787 3:168561211-168561233 CAACCTTTCTAGAAGACTGAGGG + Intergenic
965597358 3:170421992-170422014 CTGCCCTCCAGGAACCCTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
968386839 4:148107-148129 CTGCCCGCCCAGAAATCTGAAGG - Intronic
968408081 4:359551-359573 CTGCCCACCTAGAAATCTGGAGG - Intronic
968705934 4:2077506-2077528 CTGCCCTTCCAGAAGTCAGAGGG + Intronic
969097248 4:4743016-4743038 CTCCACTCCTAAGAGACTGAGGG + Intergenic
969674187 4:8606141-8606163 CTGCCCTCCATGAACCCTGACGG + Exonic
971476769 4:27080069-27080091 CTTCCCTCCTAGAACTCTGAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973033831 4:45379871-45379893 CTCCCCTGCTAGAAGAATAATGG + Intergenic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979347718 4:119608247-119608269 CTGCAGTCCAAGAAAACTGAAGG + Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981548323 4:145916853-145916875 CTGCCTTCCTAAAAGCCCGAGGG + Intronic
985869440 5:2542624-2542646 CTGCCATCCGAGAAGGCTCAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991655786 5:68902538-68902560 CTCCTCACCTAGAAAACTGAGGG + Intergenic
992041855 5:72842664-72842686 CTGCCCTCATTGCAAACTGATGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994099571 5:95878526-95878548 CTGGCCTCCAGGAAGACGGAGGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995330858 5:110944530-110944552 CTTCCCTCCTTGAAGACCGCTGG - Intergenic
997232374 5:132254221-132254243 CTGCTCTCTTAGAAGCCTGCTGG - Intronic
1001110426 5:168891515-168891537 CAGCCTTCCTAGAAAACTGTAGG - Intronic
1001655992 5:173350481-173350503 CAACCCTCATAGATGACTGAGGG + Intergenic
1006196009 6:32242865-32242887 CTGCCGTCCTAGGAGACTCTGGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006421372 6:33936076-33936098 CTGCCCTCTTAGAAGACCAGTGG - Intergenic
1008565577 6:52764760-52764782 CTCACCTCCTAGAAAACTGAGGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013287325 6:108692723-108692745 CTGCCGGCCTTGAAGACGGAGGG + Intergenic
1013719841 6:113011457-113011479 CTGCCATCAGAGAAAACTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014545922 6:122735161-122735183 CTGCTTTCCTGGAAGGCTGAAGG - Intergenic
1015258459 6:131207262-131207284 TTGTCCTCCTAGAAGCCAGATGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016166156 6:140946015-140946037 CTAACCTCCTAGAAGACTTCTGG - Intergenic
1018040291 6:159915854-159915876 CTGCCCTCCTGGAAGGGCGAAGG + Exonic
1019188798 6:170238168-170238190 CTGCCCTTCTGGAAGCCTGGAGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019657923 7:2207417-2207439 CTCCCCTCCTAGGAGGTTGAGGG - Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1022235019 7:28452929-28452951 CTGCCACACTGGAAGACTGAAGG + Intronic
1023836809 7:44073426-44073448 CTTCCCTGCAGGAAGACTGAGGG + Exonic
1024050789 7:45622091-45622113 CTGCTCTCATTGCAGACTGAGGG + Intronic
1025015344 7:55434894-55434916 CTCCCCACCTAGAAGGCTGTGGG - Intergenic
1025247644 7:57329088-57329110 CTCCCCTCCTTGAAGACTGCTGG - Intergenic
1025259813 7:57411334-57411356 ATGCATTCCAAGAAGACTGAAGG + Intergenic
1026848726 7:73711942-73711964 CTACCTTCCCAGAAGGCTGAAGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028406614 7:90482102-90482124 CTGCCCTCCCAGAAGTTGGAAGG + Intronic
1028642433 7:93058105-93058127 CAACCCTCATAGATGACTGAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1038579864 8:28738652-28738674 CTGTCCTCAGAGAAGACTCAGGG - Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040288311 8:46111577-46111599 CTCCCCTCCCAGAAGACTCCAGG - Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040538630 8:48331698-48331720 CTGCCTGGTTAGAAGACTGAAGG - Intergenic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1044743672 8:95352237-95352259 CTGTCCTCCTGGAAGTCAGAAGG - Intergenic
1045396741 8:101768372-101768394 CCGCCCTCCTACAACTCTGAAGG - Intronic
1046104172 8:109646269-109646291 CTGTGCTCCTCGAAAACTGAGGG + Exonic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1048985869 8:139734552-139734574 CTGCCCTCCAGGAAGGCTGGAGG + Intronic
1049436827 8:142590292-142590314 CTGCTCTCCCAGCAGCCTGACGG + Intergenic
1049771368 8:144383555-144383577 CTGCCAGCCTAGAAGCCTGAGGG - Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051932763 9:22406511-22406533 CTACACTCCCAGAAAACTGAGGG + Intergenic
1053052103 9:34970683-34970705 CTACCCTGCAAGAAGACTCAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056543811 9:87596423-87596445 CTGCCCAGCCAGAACACTGAAGG + Intronic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1057964851 9:99492803-99492825 CTGCCCTCCTAGAGGCATCAGGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058803045 9:108563421-108563443 CTGACCTCCCAGGAGACTGTGGG + Intergenic
1059018538 9:110548010-110548032 CTCCACTCCTAGAAGACAGAGGG + Intronic
1059234852 9:112752191-112752213 CTGCCCTCCTTGCAGTCAGAAGG + Intronic
1059453286 9:114384060-114384082 CTGCCCTCCTACAAACATGAGGG + Intronic
1059974731 9:119703342-119703364 CTGCCCTCCTTGAGGATTGTAGG + Intergenic
1061398374 9:130355507-130355529 CTGCCTCCCTGGCAGACTGAGGG - Intronic
1061803028 9:133122329-133122351 CTGGCCTCCATGAAGACTGAAGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187576505 X:20562009-20562031 CTGCCCTTCCAGAAGCCAGAAGG + Intergenic
1191077021 X:56465580-56465602 CTGGCTTCCTAGATGACTTAAGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1194436321 X:93872451-93872473 CTTCCCTATGAGAAGACTGAGGG + Intergenic
1195325666 X:103756321-103756343 CTCCCCTCCTAGGAGGCTGGGGG + Intergenic
1195337963 X:103875952-103875974 CTTCCCTATTGGAAGACTGAGGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1200717962 Y:6571768-6571790 CTGCCCTACTAACAAACTGATGG - Intergenic