ID: 979296760

View in Genome Browser
Species Human (GRCh38)
Location 4:119041763-119041785
Sequence AGCTATATGTTACACTACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979296760 Original CRISPR AGCTATATGTTACACTACGA AGG (reversed) Intronic
901328503 1:8385254-8385276 AGTTATTTGTTACACTGTGATGG - Intronic
904178411 1:28648011-28648033 TGCTATATGCTGCACTTCGAAGG - Intergenic
914329771 1:146656097-146656119 TGCTCTATGTTATACTACAAAGG - Intergenic
1064076467 10:12272839-12272861 TGCTATAATTTACACTAAGAAGG + Intergenic
1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG + Intergenic
1071540151 10:86475016-86475038 AGCAAAATGTTACACTAAGCAGG + Intronic
1091087675 11:132738546-132738568 AGCTATATGTTCCTCCAAGAAGG - Intronic
1100130073 12:91481294-91481316 GGCTATATTTTACACAATGAGGG + Intergenic
1118749193 14:68794273-68794295 AGCCATATGTTCCACTCCGGTGG - Intronic
1120641835 14:87023290-87023312 ACCTAAATGTTACAACACGAAGG - Intergenic
1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG + Intergenic
1121483197 14:94293893-94293915 AGCTATACGTTTCACTTCAATGG - Intergenic
1124255177 15:28135306-28135328 AGTTTTATGTTCCAATACGAAGG - Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1140003789 16:71054836-71054858 TGCTCTATGTTATACTACAAAGG + Intronic
1165755264 19:38289170-38289192 AGCGATATGTTCAACTATGAAGG + Exonic
925723224 2:6847874-6847896 AGCTAAATATTACATTACCATGG + Intronic
926577404 2:14597244-14597266 AGATAAATGTTACACAACAAAGG + Intergenic
943567443 2:189532723-189532745 ATGTATATATTACACTAGGAAGG + Intergenic
944215868 2:197255118-197255140 AGCCATATGTTCCACAACTATGG + Intronic
1180388237 22:12199775-12199797 AGCTATATTTTACATTGTGAAGG - Intergenic
950648764 3:14394073-14394095 AGCTTTATTTTAAACAACGAAGG + Intergenic
960629573 3:119716461-119716483 AGCTATCTGTTACAATGCGGGGG - Intronic
964152571 3:153545200-153545222 AGCAATATGTTAAACTAAGGAGG - Intergenic
972765184 4:42146279-42146301 AGCTTTATCTTCCACTAGGAGGG - Intronic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
981542758 4:145862406-145862428 ATCTATATGTTACACAAACAGGG - Intronic
989758852 5:44988154-44988176 AGCTATATTTTGCACTGTGAAGG + Intergenic
993666831 5:90709012-90709034 AGCTATGTGTTAAAATATGATGG + Intronic
993809341 5:92456503-92456525 AGCTATATGTTCAACTAAGAGGG - Intergenic
1008930930 6:56939019-56939041 AGCTAATTGATACACTACAAAGG + Intronic
1017780643 6:157712931-157712953 AGCTATAAGTGACATCACGATGG - Intronic
1024328052 7:48128305-48128327 AGATATATGTTAAACTACTTAGG + Intergenic
1024770928 7:52722600-52722622 GGCTATGTGTGACACTAAGAAGG - Intergenic
1039014914 8:33136612-33136634 AGCTTTATATTACAATACCACGG + Intergenic
1050736010 9:8764248-8764270 AGCCATATGTTTCATTACAAAGG + Intronic
1055392236 9:75835418-75835440 AGCTATGTGTTACAGTAGGGAGG + Intergenic
1193502692 X:82299256-82299278 AGCTAAATGTTCCACTAAAAGGG + Intergenic
1193513065 X:82430137-82430159 AGCAATATGTTTCGCTATGAAGG + Intergenic