ID: 979299326

View in Genome Browser
Species Human (GRCh38)
Location 4:119068500-119068522
Sequence TAGGATTCCTTAGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979299326_979299329 20 Left 979299326 4:119068500-119068522 CCTGTTTTTTCTAAGGAATCCTA No data
Right 979299329 4:119068543-119068565 TTCAAAACATACTGAGAGGTAGG No data
979299326_979299328 16 Left 979299326 4:119068500-119068522 CCTGTTTTTTCTAAGGAATCCTA No data
Right 979299328 4:119068539-119068561 AAACTTCAAAACATACTGAGAGG No data
979299326_979299330 23 Left 979299326 4:119068500-119068522 CCTGTTTTTTCTAAGGAATCCTA No data
Right 979299330 4:119068546-119068568 AAAACATACTGAGAGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979299326 Original CRISPR TAGGATTCCTTAGAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr