ID: 979306269

View in Genome Browser
Species Human (GRCh38)
Location 4:119147876-119147898
Sequence TAGAAAGCCCAAGAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979306269 Original CRISPR TAGAAAGCCCAAGAGGAGAA GGG Intronic
901345331 1:8535752-8535774 TAGGAAGAGGAAGAGGAGAAGGG + Intronic
901917355 1:12510057-12510079 TGGAAACCCCAGGATGAGAAGGG + Exonic
902308990 1:15566122-15566144 GAGGAAGCCCAAGAGAAGACTGG + Exonic
902662843 1:17917400-17917422 TGGAAAGGCCAAGACAAGAAAGG - Intergenic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
903996272 1:27307132-27307154 AGGAGCGCCCAAGAGGAGAATGG - Exonic
904311215 1:29630791-29630813 TGGGAAGTCCAAGGGGAGAAGGG - Intergenic
904868607 1:33602260-33602282 TAGAAAAACCAAGAGGTGAATGG - Intronic
904883799 1:33720555-33720577 TGTAAAGCTCTAGAGGAGAAGGG + Intronic
905520908 1:38598961-38598983 TAGAAGGCCAAAGGGGAGAGTGG - Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
906072077 1:43024350-43024372 CAGAAAATCCAAGAGAAGAAGGG + Intergenic
906812816 1:48846602-48846624 AACTGAGCCCAAGAGGAGAAAGG - Intronic
907230766 1:52996359-52996381 TTGAAAGCCCATGTGGATAATGG + Intronic
907238446 1:53067294-53067316 TAGGAGGCCCTAGAGGAGACAGG - Intronic
907810691 1:57866958-57866980 GAGAGAGCCCAAGAGGAAAAAGG - Intronic
908722004 1:67135249-67135271 AGGAAAGCACAAAAGGAGAAAGG - Intronic
908809226 1:67962334-67962356 TAGAAAGTACAACAGGAGATTGG - Intergenic
909372327 1:74898235-74898257 TAGAAATCACAACAGGAGATAGG + Intergenic
909426283 1:75528873-75528895 TAGACAGACCAAGAGGAGTTGGG - Intronic
910028366 1:82686410-82686432 AAGAAAGTCAATGAGGAGAAAGG + Intergenic
910342527 1:86204016-86204038 TAAATAGGCCAAGAGAAGAAAGG - Intergenic
911584706 1:99677761-99677783 TAAAAAGAACAAAAGGAGAATGG + Intronic
911993405 1:104732112-104732134 TAGCTAGACCAAGAAGAGAAAGG - Intergenic
912332058 1:108828743-108828765 TCAAATGCCCCAGAGGAGAAGGG - Intronic
912776854 1:112510805-112510827 TAGAAAGGGAAAGGGGAGAAGGG + Intronic
913155592 1:116093926-116093948 TAGAATGACCAAGAAGAAAAGGG - Intergenic
913294705 1:117308096-117308118 TGGATAGCAAAAGAGGAGAAGGG + Intergenic
914221396 1:145685202-145685224 TGGAAAGCCAAACAGGATAAGGG + Intronic
914473962 1:148008069-148008091 TGGAAAGCCAAACAGGATAAGGG + Intergenic
914848875 1:151299303-151299325 TAGAAAGCCCAAGACAGGCAGGG + Intronic
915073334 1:153290040-153290062 TAAAAAGACTAAGAGAAGAAAGG + Intergenic
915240979 1:154521493-154521515 TGGAACGCCCCAGAGCAGAAAGG - Intronic
915950951 1:160189721-160189743 TATAAAGCCCACAATGAGAAGGG - Intergenic
917085137 1:171297357-171297379 TAGAAAGGCTAAGGGGAGCAAGG + Intergenic
917536820 1:175880312-175880334 CAGAAGGGCCAAGAGGAGATAGG + Intergenic
917537664 1:175886113-175886135 ATGGAAGGCCAAGAGGAGAAAGG - Intergenic
917807452 1:178626467-178626489 AAGAAAGATGAAGAGGAGAAAGG - Intergenic
919361445 1:196600854-196600876 CAGAAATCTCAAGATGAGAAGGG + Intronic
920215708 1:204360291-204360313 TAGACAGCCACAGAGGTGAAAGG - Intronic
921811108 1:219515607-219515629 TAGATAATCCAAGAGGAGAGTGG - Intergenic
921965703 1:221086514-221086536 TGGAGACTCCAAGAGGAGAATGG + Intergenic
923618113 1:235554483-235554505 TAGCAAACCCAAGAGGACAGTGG - Intronic
923880686 1:238100888-238100910 TAGAAAGAAAAAGAGAAGAAAGG + Intergenic
923885525 1:238150956-238150978 TAGAGAGAGGAAGAGGAGAAAGG - Intergenic
924942575 1:248822263-248822285 TTGAAAGCCCAAGCACAGAAGGG + Intronic
1062818604 10:517817-517839 TAAAAAGCACCAGATGAGAAAGG - Intronic
1063235902 10:4116025-4116047 TAGAAACCCAAAAAGTAGAAAGG - Intergenic
1063678433 10:8162743-8162765 GAGAAAGCCAGAAAGGAGAAGGG + Intergenic
1064247696 10:13682376-13682398 CAGGAAGCTCAGGAGGAGAAGGG + Intronic
1064415984 10:15150544-15150566 CACCAATCCCAAGAGGAGAAGGG - Intronic
1064539639 10:16392304-16392326 AAGAAAAACCAAGAGGGGAAAGG + Intergenic
1065762934 10:28999831-28999853 TAGAAAATTCAAGAGAAGAATGG - Intergenic
1065942090 10:30574167-30574189 TTGAAATCACAATAGGAGAATGG - Intergenic
1066006147 10:31147782-31147804 TAGGAAGCCCAAGGGGAGGATGG + Intergenic
1066309255 10:34179837-34179859 GAAAAAGCAAAAGAGGAGAAAGG + Intronic
1067361676 10:45587130-45587152 TAGAAAGCACATGAGTGGAAAGG + Intronic
1068301961 10:55155372-55155394 TAGAAAACTGAAGAGAAGAATGG + Intronic
1069154173 10:65004661-65004683 GTGAAATCCCAAGAGGAGAGAGG + Intergenic
1070461313 10:76673275-76673297 TAGAAAGCTCTACATGAGAAGGG - Intergenic
1071348308 10:84714562-84714584 TAGAAAGAGGAAGAGGAGAGAGG + Intergenic
1071511254 10:86263948-86263970 CAGAAAGCCAGAGAGGGGAAGGG + Intronic
1073068733 10:100780142-100780164 GAGAAAGGCCAAGAGGAAAGAGG - Intronic
1073152112 10:101319117-101319139 TGGAAAGCCCATGAGTAGAAGGG + Intergenic
1073187441 10:101625151-101625173 TAGGAATCCCAAGAGCACAATGG + Intronic
1074671252 10:115795055-115795077 TAGAAAGTACAAGATGAGACTGG - Intronic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1075018720 10:118931147-118931169 TAGATAACTCAAGAGTAGAAGGG - Intergenic
1075528494 10:123205816-123205838 GAGAAAGCCCAAGTCTAGAAGGG + Intergenic
1077383681 11:2259212-2259234 TAGAAGGCCCAGGAGGAAAGGGG + Intergenic
1077547140 11:3178305-3178327 TAAAATGCCCAGGAGCAGAATGG - Intergenic
1077611648 11:3646583-3646605 TAGAAAGCCAAGGAGGAGTGCGG + Intronic
1078363899 11:10691384-10691406 TACAAAGACTTAGAGGAGAAAGG + Intronic
1078518753 11:12047070-12047092 GGGAAAGCCCTGGAGGAGAAGGG - Intergenic
1079030862 11:16985567-16985589 TAGACAGCCTAAGAGGGGCAGGG + Intronic
1079145237 11:17845397-17845419 TAGAAAAGCCAAGTGCAGAAAGG + Intronic
1079770832 11:24457512-24457534 TAGAAAACACAAGAGGAGAAGGG - Intergenic
1079888169 11:26015870-26015892 AATAAAGCCCAAAAGTAGAAAGG + Intergenic
1079981840 11:27159372-27159394 TAGTAAGAACAACAGGAGAATGG + Intergenic
1080195696 11:29605947-29605969 TAGTAAACCCAACATGAGAAAGG - Intergenic
1080778306 11:35406940-35406962 TGCAGAGCCCAAGAGGAGATTGG + Intronic
1080904762 11:36531663-36531685 TAGAAAACGCAAGAGGAGAAGGG + Intronic
1081191203 11:40104707-40104729 TAGAGGACCCAGGAGGAGAAAGG - Intergenic
1083076326 11:60042740-60042762 TGGAAAGAGAAAGAGGAGAAAGG - Intronic
1087424403 11:97969696-97969718 GAGAAAGCACAAGAGAAGAATGG - Intergenic
1088736730 11:112733742-112733764 TGGAAAGAAAAAGAGGAGAAAGG - Intergenic
1088937196 11:114414501-114414523 TAGAAATCACAACAGAAGAATGG - Intronic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1089592443 11:119552309-119552331 AAGAAGGCCCAAGAGCATAAAGG + Intergenic
1089807511 11:121104734-121104756 TAGAAGGCCCGACATGAGAATGG + Intronic
1090049274 11:123362979-123363001 AAGCAAGCCAAAGAGGAGGAGGG + Intergenic
1090093164 11:123717508-123717530 CACTAAGCCCAGGAGGAGAATGG + Intergenic
1090853991 11:130596247-130596269 TGGAAGGGCCAAGAGGAAAAGGG - Intergenic
1092500920 12:9046202-9046224 CTGAAAGCCAAAGAGAAGAAAGG + Intergenic
1092747633 12:11688694-11688716 TAGAAACCCCAGGAGGAGTGTGG + Intronic
1093370651 12:18361038-18361060 AAGAAAGCCAAAGAGAATAATGG - Intronic
1093922873 12:24879327-24879349 TAGATAACCCAATAGGAAAATGG + Intronic
1095168920 12:39010050-39010072 CAGAAAGACCAAGATGAAAAGGG + Intergenic
1095902001 12:47337458-47337480 TAGAAAATTCAAGAGGAGAAGGG + Intergenic
1096471331 12:51878459-51878481 TAAAAAGCCCAATAGGAAATGGG - Intergenic
1096556094 12:52404892-52404914 TCCAAAGGCCAAGAGGTGAATGG + Intronic
1097276268 12:57815520-57815542 TCCCAAGCCCAAGAGGAGACGGG + Intronic
1097776529 12:63653035-63653057 TGGATGGCGCAAGAGGAGAATGG + Intronic
1098658283 12:73060421-73060443 AAGAAAGCCCAAAAGAACAATGG - Intergenic
1100009961 12:89941072-89941094 TAGAAAGCCCCAGATGACCAGGG - Intergenic
1100128393 12:91458514-91458536 AGGAAAGTGCAAGAGGAGAATGG - Intergenic
1102509371 12:113403832-113403854 TAGATAGCCCACGAAGAGAGGGG + Exonic
1102624583 12:114224887-114224909 TAGAAAAGCAAAGATGAGAAAGG + Intergenic
1103211280 12:119168460-119168482 TACAAAGCCCAAGCGCAGGAGGG - Intergenic
1104402389 12:128487044-128487066 TTGAGAGCCAAAGTGGAGAAAGG + Intronic
1104917898 12:132275447-132275469 CAGCAAGACCAAGAGGAGCACGG + Intronic
1105840458 13:24249539-24249561 GAGAACCCCCAAGAGGAGATGGG + Exonic
1106541708 13:30696509-30696531 TAGAAAGCCCAGGCAGAGGAGGG + Intergenic
1106547904 13:30746222-30746244 TAAAAAGCGTAAGAGGAGAGTGG + Intronic
1106661778 13:31807647-31807669 TTTAAGGGCCAAGAGGAGAAAGG - Intergenic
1107404409 13:40099191-40099213 AAGAAAGCCTGAGAGGAGAAAGG + Intergenic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1108288115 13:48928765-48928787 TACAAAGCCAGAGAGGAGAGAGG + Intergenic
1109729110 13:66387327-66387349 TGAGAAGCCCAAGAGGAGAAAGG - Intronic
1110731269 13:78881231-78881253 TAGAAAGCCAAACAGGGGACTGG - Intergenic
1111076064 13:83237120-83237142 GGGAAAACCCAAGATGAGAAAGG - Intergenic
1111954680 13:94743258-94743280 AAGAAAGGCCAAGGGCAGAACGG - Intergenic
1113395279 13:109941542-109941564 TAGAAAACCCCAGAGGTAAATGG - Intergenic
1113548927 13:111176677-111176699 TGGAAAGCTCAAGAGCAGATGGG - Intronic
1113694915 13:112338192-112338214 TAGAAAGCTCAGGAGGAGGCTGG - Intergenic
1114875473 14:26712005-26712027 TAAAAAGACCAAGACCAGAAAGG - Intergenic
1115711117 14:36051890-36051912 TAGCAAACCCATGAGTAGAAAGG + Intergenic
1118762304 14:68888021-68888043 GGAAAAGCCCAAGAGGAGATCGG - Intronic
1120882781 14:89427269-89427291 AAAAAAGCACAAGAGGAGGAAGG + Intronic
1121654060 14:95582113-95582135 CAGAATGTTCAAGAGGAGAAAGG + Intergenic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1121712075 14:96045971-96045993 ATGAAATCCCAAGAGGAGAGTGG - Intronic
1202836166 14_GL000009v2_random:78833-78855 TGGAAAGCCCAAGGTGACAAGGG + Intergenic
1124176654 15:27431869-27431891 AAGAAATCCCAAGGGGAAAAAGG - Intronic
1124682123 15:31740656-31740678 TAGAAAGTACAAGAGGAGCTGGG + Intronic
1125333564 15:38605511-38605533 TAGAAAACAGAGGAGGAGAAAGG - Intergenic
1125377732 15:39050319-39050341 AAGACAGCACAAGAGGAAAAAGG + Intergenic
1126152253 15:45533799-45533821 TAGGAGGTCCAAGATGAGAAGGG + Intergenic
1126743272 15:51799520-51799542 CAGAAAGCCCACTAGGAGAGAGG + Intronic
1126774373 15:52087426-52087448 TAGGGAGCCCAAAAAGAGAAGGG - Intergenic
1127639260 15:60900159-60900181 TACAAAGTCCAAGATGGGAAAGG + Intronic
1127760843 15:62137708-62137730 CAGAAAGCACCAGAGGGGAAAGG + Intergenic
1127841572 15:62836255-62836277 CAGAAGGCACACGAGGAGAATGG - Intronic
1129449986 15:75646096-75646118 TGGAACCCCCAAGAGGGGAAAGG - Intronic
1130863943 15:87915953-87915975 TTGATAGCCCAAGAGCAGATGGG - Intronic
1131393944 15:92071735-92071757 CAGAGAGCCCAAGAGATGAAAGG - Intronic
1132200154 15:99947201-99947223 TAGAAAACCAAACAGCAGAATGG - Intergenic
1132329987 15:101005637-101005659 TAGAAAGTACAAGAGGAGACTGG + Intronic
1134680460 16:16121500-16121522 CAGAAAACCCTAGAGGTGAAAGG + Intronic
1135133762 16:19872848-19872870 TAGAAAAGCCAAGAGGGGAATGG + Intronic
1135326682 16:21530568-21530590 CAGACAGCCCAAGAGAAAAATGG + Intergenic
1135344702 16:21679213-21679235 TAAAATGCCCTAGAGGAGAGGGG + Intronic
1135625326 16:23989961-23989983 AAAAATGCCCAAGAGGACAAGGG - Intronic
1135954478 16:26944821-26944843 TTGAACCCCCAAGAAGAGAAAGG + Intergenic
1136336939 16:29615983-29616005 CAGACAGCCCAAGAGAAAAATGG + Intergenic
1137577463 16:49610284-49610306 TAGAAAACTCAAGAAGAGAAGGG - Intronic
1139287015 16:65824679-65824701 TAGAACCCCAAAGAAGAGAATGG - Intergenic
1142039733 16:87885318-87885340 CAGACAGCCCAAGAGAAAAATGG + Exonic
1142633904 17:1244641-1244663 TTAACAGCCCAAGAGGAAAATGG - Intergenic
1142678483 17:1530966-1530988 TTGAAAGTCCAAATGGAGAACGG + Intronic
1146314560 17:31796916-31796938 TACAAGGCCAAAGAGGGGAAGGG + Intergenic
1147031855 17:37644690-37644712 AAGAAAGCCTGAGAGAAGAAGGG + Intergenic
1147499851 17:40952453-40952475 AAGATAGCCCTGGAGGAGAAGGG - Intergenic
1147595206 17:41712390-41712412 GAGAAAACCCAGGAGGAGAGGGG + Intronic
1148699839 17:49580738-49580760 AAGAAAGCCAGAGAGGAGAATGG - Intronic
1149879091 17:60269902-60269924 TAGAAAGACTAAGAAGAAAAAGG + Intronic
1150643145 17:66963158-66963180 TAGACACCCCAAGGGCAGAAGGG + Intergenic
1150919868 17:69471332-69471354 TATACAGCCACAGAGGAGAATGG + Intronic
1150930463 17:69579195-69579217 TCTAGAGCCCAAGAGTAGAACGG - Intergenic
1151586324 17:75010908-75010930 TAGAAAACCAAGGAGGAGAAAGG + Intergenic
1151911753 17:77088204-77088226 GAGAAAGCTCAAGAGCAGAGGGG - Intronic
1152192408 17:78896801-78896823 TAGAGAGCAAGAGAGGAGAATGG - Intronic
1152348609 17:79770233-79770255 TAGGATGCCCTGGAGGAGAAGGG - Intergenic
1152986468 18:325966-325988 TAGAAAGACCAACAGTAGAAAGG - Intronic
1153794771 18:8611471-8611493 TAGAATGCAGAAGAGGAGAGAGG + Intronic
1155252030 18:23961826-23961848 AAAAAAGCCAAAGAGGAGTATGG - Intergenic
1156016166 18:32549557-32549579 TATACTGCCAAAGAGGAGAAAGG + Intergenic
1156598842 18:38579802-38579824 GAGAAAGACAAGGAGGAGAAAGG + Intergenic
1156654695 18:39271439-39271461 TAGAAACAGCAATAGGAGAAGGG - Intergenic
1159172595 18:64790808-64790830 ACTAAAGCCCAAGAGGATAAGGG + Intergenic
1160144904 18:76355890-76355912 TATAAAGGGCAAGAGGACAAGGG - Intergenic
1163622502 19:18369291-18369313 GAGAAAGAGCAGGAGGAGAAAGG - Exonic
1164305382 19:24001282-24001304 TTGAAGGCCGAAGTGGAGAAGGG - Intergenic
1166349024 19:42185561-42185583 TACAAAGGCCAAGAGGTTAAGGG - Intronic
1166520056 19:43474325-43474347 TACAAAGGCCCAGAGGTGAAAGG + Intergenic
1166689028 19:44811923-44811945 GGGAGAGACCAAGAGGAGAAGGG + Intronic
1202636471 1_KI270706v1_random:48529-48551 TGGAAAGCCCAAGGTGACAAGGG - Intergenic
925405107 2:3601006-3601028 TGGAAAGGCCAAGAGGAAAGTGG - Intronic
925548678 2:5044926-5044948 TAGAAAGCAAAAGAGGAAGAAGG + Intergenic
927140817 2:20129645-20129667 GAGAAGGCCAATGAGGAGAAAGG + Intergenic
927253303 2:21017818-21017840 TAGAAAGCACTGGAGGAGCAGGG - Intronic
927352816 2:22137883-22137905 TACAAAGAAAAAGAGGAGAAGGG + Intergenic
928239208 2:29571975-29571997 AAGAAAGCCCAGGTGAAGAATGG + Intronic
928621885 2:33098272-33098294 AACAAAGCCCAATAGGAAAATGG - Intronic
929849727 2:45574715-45574737 TTGAAAGCCCTTTAGGAGAAGGG + Exonic
930221005 2:48746687-48746709 TATAAAGCCTCAGAGGAAAATGG + Intronic
930932913 2:56910093-56910115 TAGACAAAACAAGAGGAGAATGG - Intergenic
931007196 2:57865234-57865256 AAGAAAGAGGAAGAGGAGAATGG + Intergenic
931183811 2:59930337-59930359 TAGAAATCCCAAAATGACAAGGG - Intergenic
931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG + Intronic
931762988 2:65432793-65432815 TAGGAAGCCCGAGAGGAGGGAGG + Intergenic
932624535 2:73286795-73286817 AAAAAAACCCAAAAGGAGAAGGG - Intergenic
932703608 2:74006763-74006785 CCGAAAGCCCAAGAGGTCAAGGG - Intronic
932963627 2:76444605-76444627 GAGAAAGATCAAGAGAAGAAAGG + Intergenic
932980919 2:76665186-76665208 AAGAAAGACAAGGAGGAGAAAGG + Intergenic
933358437 2:81245228-81245250 TAGAAAGTCAAGGAGGAGAGAGG + Intergenic
933415096 2:81977584-81977606 TACAAAGCACACCAGGAGAAAGG - Intergenic
934089428 2:88538373-88538395 TTGAAGGCCAAAGTGGAGAAAGG - Intergenic
934792051 2:97069863-97069885 GAGAAAGTCCAGGAGGAGACAGG + Intergenic
934814568 2:97313847-97313869 GAGAAAGTCCAGGAGGAGACAGG - Intergenic
934823126 2:97394636-97394658 GAGAAAGTCCAGGAGGAGACAGG + Intergenic
934928218 2:98396953-98396975 AAGAAGGCCCTGGAGGAGAAAGG + Exonic
935098534 2:99970308-99970330 TTGAAAGCAGAAGGGGAGAAAGG - Intronic
936283146 2:111160165-111160187 TTGGAAGGACAAGAGGAGAATGG - Intronic
937125941 2:119475100-119475122 TAGAAAGGCCAAAAAGAGAGGGG - Intronic
937912440 2:127082082-127082104 GAGACACCCCAAGAGGCGAAAGG + Intronic
938079910 2:128364483-128364505 TGGAAGGAGCAAGAGGAGAAGGG - Intergenic
938489857 2:131755730-131755752 CAGAAAGCCCATGAGGGGAAGGG + Intronic
938540610 2:132281083-132281105 TTGAAGGCCGAAGTGGAGAAGGG - Intergenic
938656961 2:133444180-133444202 GAGAAAGCCCAAAAGAAGGAAGG + Intronic
938796964 2:134725581-134725603 AAGAAAGACCAAGAAGACAAAGG + Intergenic
939878662 2:147605577-147605599 CAGCAGGCCCAAGAGGAGATAGG + Intergenic
940700371 2:157033574-157033596 AAGAAATCCCAAGCAGAGAATGG + Intergenic
941043123 2:160645373-160645395 TAGAAAGCCAAAGTTAAGAAGGG - Intergenic
941120500 2:161524473-161524495 TAGAAAACTCAAGAGGAGAAGGG + Intronic
943189487 2:184657824-184657846 TAGAAAGGGGAAGAGGAGAAAGG + Intronic
943727805 2:191269740-191269762 TAGAAAGCTCTTGAGGGGAAGGG + Intronic
944948445 2:204718056-204718078 TAGAGAACCCGAGGGGAGAAAGG + Intronic
945160533 2:206885691-206885713 TAGAAAGCCCAAGATCGAAAGGG - Intergenic
947246825 2:228057844-228057866 TAGGAAGCCAATGAGAAGAAAGG + Intronic
1168937151 20:1675123-1675145 CTGACAGCCCAAGGGGAGAATGG + Intergenic
1169613544 20:7411836-7411858 AAGAAAGACGAAGGGGAGAAAGG - Intergenic
1170235139 20:14094943-14094965 TGCAAAGCCCAGGAGGAAAAGGG - Intronic
1171869527 20:30514086-30514108 TTGAAGGCCGAAGTGGAGAAGGG - Intergenic
1171882599 20:30629460-30629482 TGGAAAGCCCAAGGTGAAAAGGG - Intergenic
1172915557 20:38440831-38440853 TAAGAAGCCGAGGAGGAGAATGG - Intergenic
1173307946 20:41869180-41869202 TAGAAAACTCAAGGGGAAAAGGG + Intergenic
1174896623 20:54456111-54456133 TAGAAAGCCATGGAGAAGAAGGG + Intergenic
1176549803 21:8216261-8216283 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1176557694 21:8260490-8260512 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1176568728 21:8399295-8399317 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1176576642 21:8443530-8443552 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1177045116 21:16159734-16159756 TGGGAAGCCCAAGATGAGAAGGG + Intergenic
1177074092 21:16550280-16550302 GAGTAAGCCAAAGAGGAGGAGGG + Intergenic
1178878068 21:36427887-36427909 GAGAGAGCCCTAGAGTAGAAGGG + Intergenic
1179107402 21:38414886-38414908 TTGAAAGTCAAAGAGAAGAATGG - Intronic
1179828121 21:43979634-43979656 TCTTGAGCCCAAGAGGAGAAAGG - Intronic
1180364399 22:11925785-11925807 TGGAAAGCCCAAGGTGACAAGGG + Intergenic
1181659276 22:24330328-24330350 TCTGAAGCCCAAGAGGAGATTGG + Exonic
1182511847 22:30825582-30825604 TACAAAGGCAAAGGGGAGAATGG - Intronic
1183031240 22:35107713-35107735 TATAAAGCTCACAAGGAGAAAGG + Intergenic
1183077820 22:35437914-35437936 GAGACAGGCCCAGAGGAGAAGGG + Intergenic
1184207386 22:43014169-43014191 TTGAAAGCCCTAGAGGAGTAAGG + Intronic
1185007226 22:48288032-48288054 TAGAAAATCCAAAAGGAAAACGG + Intergenic
1185096453 22:48808585-48808607 TGGGAAGCCCAAGAGGACAGCGG + Intronic
1203254692 22_KI270733v1_random:132587-132609 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1203262748 22_KI270733v1_random:177666-177688 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
949772570 3:7595002-7595024 TAGAAAGCACAAGAGGACATAGG - Intronic
950745309 3:15083193-15083215 TAAAGAGCTCAAGAGAAGAAGGG + Intronic
951722083 3:25710657-25710679 TAAAAAGCCCAAAGGGAGACTGG - Intergenic
952465932 3:33586070-33586092 TAGAAGTCCCAAGGGTAGAAGGG + Intronic
953558041 3:43962554-43962576 CAGAAGGCAGAAGAGGAGAAAGG - Intergenic
954568405 3:51619574-51619596 TGGAAAGGCCATGAGGAGACCGG - Intronic
955131988 3:56179283-56179305 TAGAAAGCCAAAGAAGTGCAGGG + Intronic
955475334 3:59330371-59330393 AAGAAAGGGAAAGAGGAGAAAGG + Intergenic
955778509 3:62459500-62459522 TAGAAAGACCTGGAGGTGAAAGG - Intronic
958897885 3:99849943-99849965 TTGAAAGCGGAAGAAGAGAAAGG - Exonic
958984578 3:100765709-100765731 TAGAAAACCCAAGAGTGAAATGG + Intronic
959140647 3:102482779-102482801 TTGAAGGCCAAAGAGGAGAGAGG - Intergenic
959657888 3:108830685-108830707 TAGAAGTCCCCAGAGGAAAAAGG - Exonic
960970212 3:123134307-123134329 TAGAAAGGCCAGGAAGGGAAAGG + Intronic
961258856 3:125583018-125583040 AAGAAATCCCAGGAGGATAATGG + Intronic
962607399 3:137044285-137044307 TAGAAAGGACAAGGGGAGGAAGG + Intergenic
963066805 3:141270723-141270745 TGGAGTGGCCAAGAGGAGAAGGG + Intronic
963396005 3:144734592-144734614 CAGCAAGCCGAAGATGAGAATGG - Intergenic
963843771 3:150134127-150134149 TAGAAGGCAAAGGAGGAGAAAGG - Intergenic
965841252 3:172907966-172907988 GAGAAAGCGCAATAGGAAAATGG - Intronic
966789539 3:183654218-183654240 TAGGAGGACCAAGAGGAGAATGG - Intronic
968885985 4:3332650-3332672 AAGACAGCCCAAGAGGAGAGAGG - Intronic
969991960 4:11274009-11274031 TACAAAGCCCAGGAGGTCAATGG - Intergenic
970155902 4:13141595-13141617 TAGAAGGCAAAGGAGGAGAAAGG + Intergenic
970748080 4:19323898-19323920 TATAGAGACAAAGAGGAGAATGG - Intergenic
971145109 4:23967951-23967973 GAGAGAGTCCAAGAGGTGAAGGG + Intergenic
971463509 4:26928108-26928130 TAGAAGGCCCAAGAGGCAAAAGG + Intronic
971851611 4:31992414-31992436 TAGAGAGGAAAAGAGGAGAATGG - Intergenic
973023663 4:45237789-45237811 TATAAAGACCAAAATGAGAAAGG + Intergenic
973218411 4:47697762-47697784 GAGAATTCCCATGAGGAGAAAGG + Intronic
973394328 4:49580537-49580559 TGGAAAGCCCAAGGTGACAAGGG + Intergenic
973793434 4:54399399-54399421 TAGAAAACATAAGAGGATAAAGG - Intergenic
974514025 4:62884576-62884598 TTGAAAGCCAATGAGGGGAAGGG - Intergenic
974612162 4:64230817-64230839 TAGGGAGGCAAAGAGGAGAAAGG - Intergenic
975921812 4:79399698-79399720 TAAAAAGACAAAGACGAGAATGG + Intergenic
978090142 4:104706089-104706111 TAGAAAGCACACAAGAAGAATGG + Intergenic
978104646 4:104886832-104886854 TAAAAAGTCCAAGAAGAGGAAGG - Intergenic
979306269 4:119147876-119147898 TAGAAAGCCCAAGAGGAGAAGGG + Intronic
981917496 4:150050936-150050958 TAGTAAGGCCAAGAGGGGGAAGG - Intergenic
982431702 4:155329926-155329948 CAGAAAGGCCAAGAGGATCAGGG + Intergenic
982438321 4:155402730-155402752 AAGAGAACCAAAGAGGAGAATGG + Intergenic
982480220 4:155899841-155899863 TCCAAAGCCCAGGATGAGAAAGG + Intronic
982764339 4:159326762-159326784 AAGAAAGGGCAACAGGAGAAGGG - Intronic
985276727 4:188244855-188244877 TACAAAGACCTAGATGAGAAAGG - Intergenic
1202763787 4_GL000008v2_random:134399-134421 TGGAAAGCCCAAGGTGACAAGGG - Intergenic
986932588 5:12845585-12845607 AAGAAAGTCCTAGAGGACAAGGG + Intergenic
986958758 5:13188764-13188786 CAGAAAGCCCACCATGAGAATGG - Intergenic
986996750 5:13615615-13615637 TAGAAAGCAAAAAAAGAGAAGGG + Intergenic
987959831 5:24791899-24791921 TACAAAGCCCACCAGGAAAAAGG - Intergenic
988277906 5:29106771-29106793 GAAAAATCCCAGGAGGAGAAAGG - Intergenic
988722934 5:33896657-33896679 TAGAGAGCCCAAGAAAAGCAAGG + Intergenic
989146290 5:38253444-38253466 TAGAAAACCCAATAGAAAAATGG + Intergenic
990864854 5:60369113-60369135 TAGAAAGCAGGAGAGGAGAGAGG - Intronic
991475103 5:67010719-67010741 TGGAAATCCCAGGAGGAAAATGG + Intronic
992039040 5:72810235-72810257 TAGAAAACTCAAGAGGAGAAGGG + Intergenic
992778267 5:80106463-80106485 CAGAAAGTCTAAGAGAAGAAGGG + Intergenic
993669805 5:90746941-90746963 TAGAGAGGGCAAGGGGAGAAAGG + Intronic
994181597 5:96773080-96773102 TCAAAAGCCCAAGAGGAAAGGGG - Exonic
996453366 5:123653122-123653144 TACTAAGCCCAAGAGGTAAAAGG - Intergenic
997230830 5:132241613-132241635 CAGAAATCCCAATAGGAAAATGG - Intronic
999448596 5:151661190-151661212 TAGAAAGCTCCAGGGGAGCAAGG + Exonic
999994049 5:157075038-157075060 TAGAAACCAAAAGATGAGAAAGG + Intergenic
1000513837 5:162216178-162216200 TAGCAAGGCCAAGAGAAGGATGG + Intergenic
1000664840 5:163982081-163982103 TAGAAAGCATAAGAGGAAAAGGG - Intergenic
1000988785 5:167890106-167890128 CAGAGGGCCCAAGAGGAGAAGGG - Intronic
1001055328 5:168444701-168444723 TAGAGAACCCATGAGGAGAGGGG - Intronic
1002384511 5:178856243-178856265 TAGAAGACTCAAGAGGAGAAGGG + Intergenic
1003786232 6:9490110-9490132 TAGAAATAGTAAGAGGAGAAGGG + Intergenic
1003976244 6:11347107-11347129 GAGCAAGCCCAAGAGGTGCAGGG + Intronic
1004216622 6:13710701-13710723 TAGAATGCCCCAGGGTAGAAAGG - Intronic
1004558930 6:16728586-16728608 TAGAAAACTCCAAAGGAGAATGG + Intronic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1005488208 6:26321240-26321262 GAGAAAGGCCACGATGAGAAAGG - Intergenic
1006536779 6:34705478-34705500 TAAAAGGGCCAAGAAGAGAAGGG - Intergenic
1006716866 6:36126043-36126065 TTGAAAGCCCCAGAAGAGCATGG + Intergenic
1007102565 6:39259839-39259861 CAGATAGCCAGAGAGGAGAAGGG - Intergenic
1007133721 6:39500590-39500612 GAGAGAACCCAGGAGGAGAAAGG - Intronic
1008557706 6:52690829-52690851 AGGAAAGCCCAAGAGGACACTGG + Intergenic
1008632774 6:53379664-53379686 TAGAAGGTCTAAGAGAAGAATGG + Intergenic
1009436057 6:63619743-63619765 TAAAAAGCCTAAGAGTGGAAGGG - Intergenic
1010298236 6:74226708-74226730 TAGGAAACTCAAGAGGAGAAGGG + Intergenic
1011104630 6:83765923-83765945 CAGAAAGCGAAAGAGGAGAAAGG - Intergenic
1012347292 6:98206520-98206542 TATAAAGTCCAAAAGGAGACTGG + Intergenic
1012997764 6:105990666-105990688 TAGAATGTCCAAAGGGAGAATGG + Intergenic
1013338818 6:109192696-109192718 GAGAAGGCAAAAGAGGAGAAAGG - Intergenic
1014345248 6:120262306-120262328 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1014643064 6:123937963-123937985 TTCAAGGCCCAAGAGGAGCAAGG - Intronic
1015797050 6:137023531-137023553 TGTATAGACCAAGAGGAGAAGGG + Intronic
1016779872 6:147945298-147945320 TAGAAATCCCAAGAAGATAGAGG - Intergenic
1018132019 6:160740642-160740664 TAGTAAGTTCAAGAGGATAAAGG - Intronic
1018431452 6:163725933-163725955 AAGACAGCCCCAGAGGAAAAAGG - Intergenic
1019108361 6:169689208-169689230 TGGAAAGCCCGTGAGAAGAATGG - Intronic
1019903654 7:4043975-4043997 AAGAAAACACAAGAGGAGGAAGG - Intronic
1020496832 7:8864683-8864705 CAGAAAGACCAAGAAGAGATGGG - Intergenic
1022829726 7:34053714-34053736 GAGTAAGCCGAAGAGGAGGAGGG + Intronic
1022877853 7:34553189-34553211 GTGAAAGCCCACGAGGAGACTGG + Intergenic
1022935441 7:35170635-35170657 TGGATGGCACAAGAGGAGAATGG + Intergenic
1022953859 7:35363762-35363784 TAGAAAGCCTACAAAGAGAAGGG + Intergenic
1023533867 7:41187597-41187619 TGGAAAGGCCCAGAGGCGAAGGG - Intergenic
1024444819 7:49465089-49465111 TATAAAGCCCATAAGGAAAAGGG + Intergenic
1026033054 7:66811928-66811950 TAGAAAACCCAAGAGAAGGCTGG + Intergenic
1026433807 7:70375524-70375546 TAAAAGGCCCATGAGGGGAATGG - Intronic
1029831399 7:103263404-103263426 TGGATTGCACAAGAGGAGAATGG + Intergenic
1030741296 7:113113162-113113184 TAGAAAGCCCAGCAGGACACAGG + Intergenic
1032458336 7:132090932-132090954 TTGAAAGACCAAGAAGAGAAAGG + Intergenic
1032670107 7:134074582-134074604 GAGGAGGCCCAAGAGGAGAGTGG + Intergenic
1032878771 7:136066238-136066260 TAGAAATCCCAAGATGAAATAGG - Intergenic
1033506273 7:142004523-142004545 TAGAGACTCCAAAAGGAGAAAGG + Intronic
1034467192 7:151236965-151236987 AAGAAAGCCCAAGGGTAGAAGGG + Intronic
1035123525 7:156590353-156590375 CAGAAAGCCCCAGAGGTCAAGGG + Intergenic
1035627913 8:1087820-1087842 TGGCAAGCCCATGAAGAGAAAGG - Intergenic
1035636533 8:1150596-1150618 TAGAAAATCCAAGGAGAGAAGGG + Intergenic
1037718933 8:21425253-21425275 TAGAAAGTCTAACAGGAAAAAGG - Intergenic
1037731010 8:21524088-21524110 CAGAGAGCACAGGAGGAGAATGG - Intergenic
1039489061 8:37934159-37934181 GAGAAAGGCCCAGAGGGGAAGGG - Intergenic
1039912031 8:41833573-41833595 AAGAAAGCCGAAGATGGGAATGG + Intronic
1039932189 8:42003275-42003297 CAGAAAGCCCAACAGCAGCAGGG + Intronic
1042692510 8:71517067-71517089 TAGAACCAGCAAGAGGAGAAGGG - Intronic
1043553495 8:81402473-81402495 CAGAAAGCCCTGGAGGAGCAGGG - Intergenic
1043910200 8:85855169-85855191 GAGAAAGCCCATGAAGACAATGG - Intergenic
1043935196 8:86134422-86134444 AAGAAAACTCAAGAGGAGAAAGG - Intronic
1044005368 8:86931392-86931414 TGCACAGCCCAAGAGGACAAAGG - Intronic
1044061023 8:87635823-87635845 TTGAAAGACCAAGAAGAGAATGG - Intergenic
1044305706 8:90638297-90638319 TAGAAAGGCCCAGAGGGAAAGGG - Intronic
1044459180 8:92425343-92425365 TAGAAAGCCCAAGGGAACACTGG + Intergenic
1046177980 8:110604413-110604435 TAGATAACTCAAGAAGAGAAAGG + Intergenic
1046311470 8:112442604-112442626 TAAAAAGACAAAGGGGAGAATGG - Intronic
1046638188 8:116696123-116696145 TAGATCGTCCAAGAGAAGAATGG - Intronic
1046730188 8:117717022-117717044 TAGAAATACCAAGAGCAGGATGG + Intergenic
1046995796 8:120521113-120521135 TAAAAAGACCAAAAGCAGAAAGG + Intronic
1047362152 8:124178981-124179003 TATAAACCCCATGAGGATAAGGG - Intergenic
1048823192 8:138398275-138398297 TAAAAAGACCAAGAGGAAAGAGG + Intronic
1049215176 8:141404521-141404543 AAGAGAGCTCACGAGGAGAAAGG - Intronic
1051455444 9:17251357-17251379 TGGGAATCCCAACAGGAGAAGGG - Intronic
1051544405 9:18258404-18258426 CAGAAAGCCACATAGGAGAAAGG + Intergenic
1051754316 9:20380119-20380141 TAGAAAGCCCAAGTGAATAAAGG - Intronic
1053525414 9:38825285-38825307 TAGAAAGACTAAGAAGAAAAGGG - Intergenic
1054197643 9:62049712-62049734 TAGAAAGACTAAGAAGAAAAGGG - Intergenic
1054640766 9:67538989-67539011 TAGAAAGACTAAGAAGAAAAGGG + Intergenic
1054992206 9:71341580-71341602 TTGAATGCTCAATAGGAGAAGGG + Intronic
1055730495 9:79275474-79275496 TAGTAAGCCAAAGAAGTGAAGGG - Intergenic
1056446518 9:86671748-86671770 TCAAAAGCCCCAGAGGACAAGGG - Intergenic
1056941935 9:90963251-90963273 TGGAAGGCAAAAGAGGAGAAAGG - Intergenic
1058331509 9:103767184-103767206 TTTAAAGCCCATGAGTAGAATGG + Intergenic
1058638381 9:107058679-107058701 AGGAGATCCCAAGAGGAGAATGG + Intergenic
1059351657 9:113669724-113669746 ATGTAAGCCCAAGAGGAAAAGGG - Intergenic
1059946801 9:119417456-119417478 AAGAAAGCTCAAGTTGAGAAAGG - Intergenic
1059992828 9:119881415-119881437 TAGGAGGACAAAGAGGAGAAAGG + Intergenic
1060215441 9:121736063-121736085 TAGACAGCCTAAGCTGAGAAGGG - Intronic
1060505650 9:124196771-124196793 AAAACAGCCCAAGAAGAGAAGGG + Intergenic
1203471093 Un_GL000220v1:115732-115754 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1203478914 Un_GL000220v1:159704-159726 TTGAAGGCCGAAGTGGAGAAGGG + Intergenic
1203544540 Un_KI270743v1:119272-119294 TGGAAAGCCCAAGTTGACAAGGG - Intergenic
1186255107 X:7709525-7709547 TAGAAGGCAAAAGAGGAGAAAGG - Intergenic
1186292610 X:8116849-8116871 CAGAAAGCACAAGAGAATAAAGG + Intergenic
1187213223 X:17250026-17250048 TCTAAAGCCCAAGAGGAGGGTGG + Intergenic
1187522325 X:20024670-20024692 CCCAAAGTCCAAGAGGAGAATGG + Intronic
1187743337 X:22380545-22380567 CAGAAAGCGGAAGAGCAGAAAGG - Intergenic
1187930757 X:24291735-24291757 AAGAAAGTCTAAGAGGAGAAGGG + Intergenic
1188239835 X:27772449-27772471 TAAAAATCCCAAAAGGAGAAAGG - Intergenic
1189100707 X:38186491-38186513 TAGAAAGTACAAAAGGAGGAAGG + Intronic
1189165496 X:38856864-38856886 AAGAAAGGCAAAGAGGAGAAAGG - Intergenic
1189283883 X:39838423-39838445 GATAGAGCCCCAGAGGAGAACGG + Intergenic
1189840789 X:45074295-45074317 TAAAAATCCAAAGTGGAGAAAGG - Intronic
1189890296 X:45594232-45594254 TAGAAAACTCAGGAAGAGAAGGG + Intergenic
1190751490 X:53365892-53365914 TAGTAAACCCAATAGGAAAATGG - Intergenic
1191806120 X:65135293-65135315 TGGAAAACTCAAGAGGAGAAGGG + Intergenic
1192167192 X:68833435-68833457 CAGAGAGCCCAAGGGAAGAAAGG - Intronic
1192590263 X:72353752-72353774 TAGATAGCGCAACAGAAGAAAGG + Intronic
1192613675 X:72594409-72594431 TAGAAAGACCAAGAAAAAAAGGG + Intronic
1195354518 X:104026319-104026341 TTGACATCCCAGGAGGAGAAAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198303013 X:135349924-135349946 GAGAAAGTCCAAGTGGAGAAAGG + Intronic
1198658186 X:138937475-138937497 TAGAAATACCATGAGGACAAGGG - Intronic
1198937170 X:141910702-141910724 TAGATAGGCCTAGAGAAGAAAGG + Intergenic
1198961881 X:142192163-142192185 TAGATAGGCCTAGAGAAGAAAGG - Intergenic