ID: 979309358

View in Genome Browser
Species Human (GRCh38)
Location 4:119184056-119184078
Sequence CTTTGGGAGGAGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146374
Summary {0: 1, 1: 16, 2: 1762, 3: 31024, 4: 113571}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979309358_979309364 -8 Left 979309358 4:119184056-119184078 CCATCCACCTTCTCCTCCCAAAG 0: 1
1: 16
2: 1762
3: 31024
4: 113571
Right 979309364 4:119184071-119184093 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
979309358_979309367 5 Left 979309358 4:119184056-119184078 CCATCCACCTTCTCCTCCCAAAG 0: 1
1: 16
2: 1762
3: 31024
4: 113571
Right 979309367 4:119184084-119184106 GGATTACAGGTGCGAACCACTGG 0: 1
1: 55
2: 956
3: 2366
4: 2941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979309358 Original CRISPR CTTTGGGAGGAGAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr