ID: 979318926

View in Genome Browser
Species Human (GRCh38)
Location 4:119300542-119300564
Sequence TAGGGTTGTTACGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979318926_979318931 10 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318926_979318934 25 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG 0: 1
1: 0
2: 0
3: 0
4: 26
979318926_979318929 3 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979318926 Original CRISPR TAGGGTTGTTACGAAGCTGC AGG (reversed) Exonic
1064352829 10:14592341-14592363 CAGAGTTGCTACGAACCTGCTGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1081292104 11:41339013-41339035 TTGGGCTGTTAGGAAGCTTCTGG + Intronic
1090620609 11:128557697-128557719 TGGGGTTTTTATGAAGGTGCAGG - Intronic
1091362009 11:134985423-134985445 TAGGGTTTTTACTAAGCTCGAGG + Intergenic
1097275801 12:57812852-57812874 TAATGATGTTAGGAAGCTGCAGG - Intronic
1097516922 12:60617855-60617877 TAGGGTAGGTACTGAGCTGCAGG + Intergenic
1106811910 13:33366672-33366694 TATCGTTGTTACTGAGCTGCAGG - Intergenic
1109690570 13:65882627-65882649 AAGGGATGTTTCGAAGCTGAGGG - Intergenic
1110457274 13:75703548-75703570 TAGGGTTGCTACAAAGATTCAGG + Intronic
1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1129515209 15:76153089-76153111 TCAGGTGGTTAGGAAGCTGCAGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1137735792 16:50722167-50722189 TAGGGGTGTTAGGAAGAAGCAGG + Intronic
1142713763 17:1737090-1737112 TAGGGTTGTTACGAAGGTCAAGG + Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148965863 17:51435541-51435563 TTGGGCAGTTACGCAGCTGCTGG + Intergenic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1150991800 17:70268444-70268466 TAAGGGTGTTAAGAACCTGCAGG - Intergenic
1155790223 18:29958022-29958044 TATGGTTGTTACGCAGCTACAGG + Intergenic
926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG + Intronic
937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG + Intergenic
939625641 2:144473697-144473719 TAGGGTTGTTACAGAGGTGCAGG + Intronic
1173482839 20:43416704-43416726 TAGGGTTGTTTCTCAGTTGCAGG - Intergenic
1180043049 21:45290087-45290109 TAGGGTTATTTTAAAGCTGCAGG + Intergenic
1180289581 22:10784484-10784506 TGGGGTGGGTAAGAAGCTGCTGG - Intergenic
1180305316 22:11068315-11068337 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
951114279 3:18841515-18841537 TATGGTTGTTAAGAAGCTATGGG - Intergenic
954493367 3:50929402-50929424 TATGGTTTTTAGCAAGCTGCAGG - Intronic
955036074 3:55269306-55269328 TTGGGTTTTTACAAATCTGCTGG + Intergenic
964945622 3:162220207-162220229 TGGGGTTGTTACAAAGCCACTGG + Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
970475978 4:16423469-16423491 TATGGTTGTTACTAGCCTGCTGG + Intergenic
973968488 4:56187488-56187510 TAGGCTTGATCCAAAGCTGCTGG - Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
986802329 5:11275013-11275035 TAGAGTTGGTAGGAAGCTGGAGG + Intronic
991004426 5:61813670-61813692 TAGGGTTGTTTTGAAGTTCCTGG - Intergenic
994332120 5:98518676-98518698 TAGGGTTTTTATGAAGTTGAAGG + Intergenic
995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG + Intergenic
1002724216 5:181283673-181283695 TGGGGTGGGTAAGAAGCTGCCGG + Intergenic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1033112884 7:138597986-138598008 GAGTCTTGTTACGAAGCTTCAGG - Intronic
1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG + Intergenic
1038767570 8:30443126-30443148 TCGGGTTGTGGAGAAGCTGCAGG - Intronic
1039504731 8:38043732-38043754 CAGGGGTCTTATGAAGCTGCTGG - Intronic
1039820063 8:41127104-41127126 TAGGGTTGTAAACAACCTGCAGG + Intergenic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1051485515 9:17604064-17604086 TACGCTTGTTACAAAACTGCTGG + Intronic
1053886357 9:42647106-42647128 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1054225377 9:62454555-62454577 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1056511025 9:87305851-87305873 TTGGGTTGTTTAGAAGCTGGAGG - Intergenic