ID: 979318929

View in Genome Browser
Species Human (GRCh38)
Location 4:119300568-119300590
Sequence ACCGAAAATGCTTAAGTTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979318921_979318929 29 Left 979318921 4:119300516-119300538 CCCGGTGCGTCCACCTCCATCTC 0: 1
1: 0
2: 1
3: 25
4: 182
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105
979318925_979318929 13 Left 979318925 4:119300532-119300554 CCATCTCGCTCCTGCAGCTTCGT 0: 1
1: 0
2: 1
3: 8
4: 193
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105
979318924_979318929 16 Left 979318924 4:119300529-119300551 CCTCCATCTCGCTCCTGCAGCTT 0: 1
1: 0
2: 3
3: 29
4: 284
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105
979318926_979318929 3 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105
979318922_979318929 28 Left 979318922 4:119300517-119300539 CCGGTGCGTCCACCTCCATCTCG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105
979318923_979318929 19 Left 979318923 4:119300526-119300548 CCACCTCCATCTCGCTCCTGCAG 0: 1
1: 0
2: 3
3: 44
4: 450
Right 979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979318929 Original CRISPR ACCGAAAATGCTTAAGTTCC CGG Exonic
905254722 1:36672930-36672952 ACTGCAAATGCTTAAGGGCCAGG - Intergenic
906422482 1:45681943-45681965 ACCGAAATTACTTAACTTCTTGG + Intronic
909351577 1:74659509-74659531 ACCCAAAGTGCTTATGTGCCTGG + Intronic
909806658 1:79881168-79881190 ACCTAAAATGGTTAAAATCCTGG + Intergenic
910677799 1:89832341-89832363 ACAGAAAATGCTGAAATTCCAGG - Intronic
919260255 1:195183384-195183406 AGAGAAAATGGCTAAGTTCCTGG - Intergenic
921476096 1:215612239-215612261 ATGGAAAATATTTAAGTTCCAGG - Intronic
923462953 1:234222924-234222946 ACAGAAAATGGTGAAATTCCAGG + Intronic
1063399281 10:5726372-5726394 ACAGAAAATAATCAAGTTCCAGG - Intronic
1063472151 10:6296876-6296898 ACCTAGAATGCCTAACTTCCTGG + Intergenic
1063735917 10:8754196-8754218 ACCCAAAAAGCTGAAGTTTCTGG - Intergenic
1064921471 10:20523713-20523735 AAAGAAAATGCTGAACTTCCAGG + Intergenic
1068079002 10:52294941-52294963 AGTGAAAATGCTTGAGTTTCTGG - Exonic
1068187742 10:53608304-53608326 ACTGCAAATGCTTCATTTCCTGG + Intergenic
1071083702 10:81842872-81842894 AGAGAAAATGCTTATGTTGCAGG + Intergenic
1079294275 11:19218445-19218467 ACCTAAAATGTTTCAGCTCCTGG + Intergenic
1081997019 11:47372346-47372368 ACCCAAAATGCTGAAATTACAGG + Intronic
1083083728 11:60121058-60121080 CCCCAAAATGCTTAGGTACCAGG - Intergenic
1083101771 11:60314830-60314852 CTCGAAAGTACTTAAGTTCCTGG - Intergenic
1083496128 11:63055345-63055367 ACAGAAAATGAATAAATTCCTGG - Intergenic
1083577511 11:63802800-63802822 GCCGTAAATGACTAAGTTCCAGG - Intergenic
1083953213 11:65968204-65968226 TCCGAAAATGCTAAAATTACAGG + Intronic
1086084255 11:82938663-82938685 ACCCAAAATGCTGAAATTACAGG + Intronic
1088169383 11:106978386-106978408 AACAAAAATACTTAAATTCCAGG - Intronic
1090966229 11:131599744-131599766 ACAGAAAAAGTTTAAGTGCCTGG + Intronic
1095555471 12:43498823-43498845 ACCAAAACTGATCAAGTTCCAGG + Intronic
1098710307 12:73750076-73750098 ACCTAAAATGTCTAAGTTCAAGG + Intergenic
1098936042 12:76480646-76480668 AATGAAAATTCTTAAGTTGCAGG - Intronic
1099332697 12:81310387-81310409 TCCTAAAATGTTTAAGTTCGAGG + Intronic
1101130962 12:101690764-101690786 TCTAAAAATGCTTAATTTCCTGG - Intergenic
1102995481 12:117346844-117346866 ACAAAAAATGCTTCAGATCCAGG + Intronic
1107321685 13:39195666-39195688 AAGGAAAATGATTAATTTCCTGG + Intergenic
1108441091 13:50453540-50453562 ACTGGAAATACTTAGGTTCCTGG - Intronic
1116047060 14:39756463-39756485 ACCAAAAATGTTTAAGATCTAGG + Intergenic
1122638704 14:103143756-103143778 ACTAACAATGCCTAAGTTCCTGG - Intergenic
1123502053 15:20896330-20896352 TCCTAAAATGCTTAAATTACAGG - Intergenic
1123559302 15:21470013-21470035 TCCTAAAATGCTTAAATTACAGG - Intergenic
1123595537 15:21907310-21907332 TCCTAAAATGCTTAAATTACAGG - Intergenic
1124597161 15:31101123-31101145 CCAGAAAATGCTGAAGTTCTAGG - Intronic
1125391610 15:39198663-39198685 ACCGATAAAGCTGAAGTTACAGG - Intergenic
1129220272 15:74128338-74128360 ACAGCAAATGCTTTTGTTCCCGG - Exonic
1131163286 15:90123693-90123715 TCCCAAAGTGCTTAAGTTACTGG - Intergenic
1202967651 15_KI270727v1_random:197172-197194 TCCTAAAATGCTTAAATTACAGG - Intergenic
1136517709 16:30777846-30777868 ACAAAACATGCTTGAGTTCCTGG + Intergenic
1137028547 16:35501335-35501357 ACCACAAATGCTTAAGTGCCTGG - Intergenic
1139876225 16:70148305-70148327 CCCGAAAGTGGTTAACTTCCAGG - Intronic
1142664471 17:1455020-1455042 ACCGACAATGTTTAAGTCCAAGG + Intronic
1147693797 17:42336038-42336060 AACGAAGAAGCTTAAGTTCTGGG - Intronic
1149558929 17:57594338-57594360 AACCAAAAAGATTAAGTTCCTGG + Intronic
1149591625 17:57834174-57834196 ACAGAAACTGCTTCAGTGCCGGG + Intergenic
1150864482 17:68835143-68835165 TCCTAAAATGGTTAAATTCCTGG + Intergenic
1153929686 18:9867095-9867117 ACAGAAAATTCATGAGTTCCTGG + Intergenic
1160593529 18:79958623-79958645 ACCACAAATGCTCAAGTGCCCGG + Intergenic
1161083168 19:2321569-2321591 AAGGAAAATGCTTCCGTTCCAGG + Exonic
1162805243 19:13134875-13134897 ACTGAATATGCTTAAGTGCTCGG - Intronic
1167652248 19:50738718-50738740 ACCGAAAATGCCAAATTTCAGGG + Intergenic
1168673704 19:58260819-58260841 ATCCAAAATGCCTAAGTTACTGG - Intronic
930084144 2:47480781-47480803 ACTGAAACTCCTCAAGTTCCAGG - Exonic
930510116 2:52334360-52334382 ACTAAAAATGCCTAACTTCCTGG - Intergenic
931535786 2:63274703-63274725 ACAGGAAATGCATAAGTTCCTGG + Intronic
938749268 2:134313303-134313325 ATCAAAAATGCTTAAGATTCAGG - Intronic
939909821 2:147966602-147966624 AAAGGAAATGGTTAAGTTCCTGG + Intronic
944492955 2:200276953-200276975 ACTGTAAATTCTTAAGTTCATGG - Intergenic
944557987 2:200906691-200906713 ACTAAAAATGCTTAATTACCTGG - Intergenic
1169657351 20:7939949-7939971 ACAGTAAATGCTTATGTTCATGG - Intronic
1179816968 21:43912444-43912466 ACGGAAAATCCACAAGTTCCTGG - Intronic
950291989 3:11792115-11792137 ACCTTAAATGTTTAAGATCCAGG - Intronic
952170822 3:30805273-30805295 ACCAAAAATGCTTAGATTCAGGG + Intronic
959544783 3:107581710-107581732 AACTCAAATTCTTAAGTTCCTGG - Intronic
960807842 3:121601056-121601078 CCAGAAAATGCCTGAGTTCCGGG - Intronic
962953962 3:140247344-140247366 ATGGGAAATGCTTTAGTTCCAGG + Intronic
962971409 3:140405038-140405060 ACCGAAGATGGTTGATTTCCTGG + Intronic
966730789 3:183149904-183149926 AAAGTAAATGCGTAAGTTCCTGG + Intronic
967051793 3:185791817-185791839 AACAAAAATGCTACAGTTCCAGG + Intronic
971106365 4:23528587-23528609 ACAGAAAATGCTTTACTTCCTGG - Intergenic
976089628 4:81442997-81443019 AAAGAATATGCTAAAGTTCCAGG + Intronic
979318929 4:119300568-119300590 ACCGAAAATGCTTAAGTTCCCGG + Exonic
981497730 4:145412441-145412463 AGAGAAAATGATTAAGTGCCGGG - Intergenic
983550679 4:169014375-169014397 ACCTAAAATGGTTAAGTGCCAGG + Intergenic
987165151 5:15190247-15190269 TCCGAAAATGCTGAGATTCCAGG + Intergenic
988476786 5:31593430-31593452 ATAGAAAATGCTTATCTTCCAGG - Intergenic
988567135 5:32328513-32328535 ACAGAAAATGGTAAAGTTCTTGG - Intergenic
999056090 5:148578562-148578584 AAAGAAAATGCTTAAGTTCCAGG - Intronic
999883481 5:155893142-155893164 ACCGTAAATGTTTGAGATCCTGG + Intronic
1004453143 6:15766150-15766172 ACAGAAAACGCTTGAGCTCCAGG + Intergenic
1004454653 6:15780959-15780981 AATGAAAATGCTTATGTGCCAGG - Intergenic
1005105386 6:22219181-22219203 AGAGCAAATGCTTAAGTTGCAGG + Intergenic
1008318978 6:50083308-50083330 ACCAAAAATGCTTCTGTTTCAGG + Intergenic
1013024742 6:106260431-106260453 CCAGACTATGCTTAAGTTCCTGG - Intronic
1013182898 6:107732861-107732883 CAGGAAAATGCTGAAGTTCCTGG + Intronic
1014330461 6:120057516-120057538 ACAGAAAATGAATAAATTCCTGG + Intergenic
1015336265 6:132042773-132042795 ACTTAAAATGCTAAAATTCCAGG + Intergenic
1017102503 6:150861237-150861259 TCCGTAATTGCTTCAGTTCCTGG - Intergenic
1017580824 6:155863422-155863444 AGAGAAAATGCATAAATTCCTGG + Intergenic
1018990925 6:168673182-168673204 ATAGAAAATGCTTAAGTTGTAGG - Intronic
1023516074 7:41003108-41003130 ACCGACATTTATTAAGTTCCAGG - Intergenic
1026614338 7:71888167-71888189 AACAAAAATGCTTAAGATGCTGG + Intronic
1028349144 7:89823213-89823235 ATCTAATATGCTTAAGTTACAGG + Intergenic
1028739509 7:94257542-94257564 ACTGAAAATGCCTAAGGTCTTGG + Intergenic
1029351997 7:100020065-100020087 AGTGAAAATGCTTAAATACCCGG + Intronic
1030345723 7:108430945-108430967 ACTGAAAATCCATAAGCTCCAGG + Intronic
1033030630 7:137822503-137822525 ACAGAAAATGCTAAAGTTTAGGG + Intronic
1050911203 9:11073479-11073501 ACTCAAAATGCATAAGTTCAGGG - Intergenic
1059680068 9:116577268-116577290 ACCCAAAATGCTGAGGTTACAGG - Intronic
1059955400 9:119510546-119510568 ACTGAAAAACCTTAATTTCCAGG + Intronic
1060289179 9:122284605-122284627 ACAGAAAATTCTTCAGCTCCAGG + Intronic
1187023455 X:15408344-15408366 ACAGAATATGCATCAGTTCCAGG + Intronic
1190165065 X:48066871-48066893 ACAGAAAATGATTGAGTCCCAGG - Exonic
1191639826 X:63417958-63417980 ACAGAAAATGTATAAATTCCTGG - Intergenic
1193625030 X:83808249-83808271 AGAGGAAATGCATAAGTTCCTGG - Intergenic
1194047685 X:89029231-89029253 ACAGAAAATGAATAAATTCCTGG - Intergenic
1202097703 Y:21269789-21269811 AGAGAAAATGGTTAAGTTTCTGG + Intergenic