ID: 979318931

View in Genome Browser
Species Human (GRCh38)
Location 4:119300575-119300597
Sequence ATGCTTAAGTTCCCGGACTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979318924_979318931 23 Left 979318924 4:119300529-119300551 CCTCCATCTCGCTCCTGCAGCTT 0: 1
1: 0
2: 3
3: 29
4: 284
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318926_979318931 10 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318927_979318931 -8 Left 979318927 4:119300560-119300582 CCCTAGAAACCGAAAATGCTTAA 0: 1
1: 0
2: 1
3: 11
4: 154
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318925_979318931 20 Left 979318925 4:119300532-119300554 CCATCTCGCTCCTGCAGCTTCGT 0: 1
1: 0
2: 1
3: 8
4: 193
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318923_979318931 26 Left 979318923 4:119300526-119300548 CCACCTCCATCTCGCTCCTGCAG 0: 1
1: 0
2: 3
3: 44
4: 450
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70
979318928_979318931 -9 Left 979318928 4:119300561-119300583 CCTAGAAACCGAAAATGCTTAAG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979318931 Original CRISPR ATGCTTAAGTTCCCGGACTT TGG Exonic
905515553 1:38559396-38559418 ATGGTTAAGTGCCTGGACTCTGG - Intergenic
906933265 1:50189894-50189916 ATGCTTATGATCCCTGACTGTGG - Intronic
910162775 1:84291945-84291967 ATGTTTGAGTTCCCTGACTCTGG - Intergenic
911266373 1:95749356-95749378 ATACTTGAGTTCCAGGAGTTAGG + Intergenic
917047497 1:170877887-170877909 ATGGTTAAGAACCTGGACTTGGG - Intergenic
921256532 1:213345745-213345767 CTGCTTAGGTTCTCAGACTTAGG + Intergenic
921795778 1:219343061-219343083 ATGGTTAAGTTGTCGGACTTGGG - Intergenic
924657608 1:245987731-245987753 GTGCTTAAGTGCCGGGACTTTGG - Intronic
1064567398 10:16655324-16655346 ATGCTTAAGAGCACGGGCTTGGG + Intronic
1070770176 10:79077711-79077733 ATGTTTAACTTCTCCGACTTTGG + Intronic
1078904671 11:15672669-15672691 ATGTTGAAGTCCCCAGACTTGGG + Intergenic
1079029760 11:16977709-16977731 ATGCCTAAGTGCCCAGACTGTGG + Intronic
1080854424 11:36099975-36099997 ATGCTGATGCTCCCGGACTGAGG - Intronic
1081365202 11:42226496-42226518 ATGCTAAACTTCTGGGACTTCGG - Intergenic
1087371454 11:97290380-97290402 TTACTTCAGTTCCTGGACTTAGG + Intergenic
1088648145 11:111934094-111934116 ATGGTTAAGAACCTGGACTTTGG + Intronic
1094460740 12:30695216-30695238 TTCCTTAAGTGCGCGGACTTGGG - Intronic
1098455658 12:70670342-70670364 ATGATTAAGTGCCTGGGCTTTGG + Intronic
1100082519 12:90870248-90870270 ATGCCTGTATTCCCGGACTTTGG + Intergenic
1100724959 12:97398426-97398448 ATGTTTGAGTTTCTGGACTTTGG + Intergenic
1102039206 12:109789871-109789893 ATGCTTCTGTTCCCACACTTTGG - Intronic
1117554834 14:56873169-56873191 AAGCCTAAGTTCCCAGAGTTTGG - Intergenic
1121987737 14:98524393-98524415 ATGATTAAGATCCTAGACTTTGG - Intergenic
1125618784 15:41040609-41040631 ATGCCTAAGTCCCAGCACTTTGG + Intronic
1127370939 15:58339921-58339943 ATGCTTATAATCCCGAACTTCGG - Intronic
1129815117 15:78545526-78545548 ATGCTTAAGTTCACAGAGTAGGG + Intronic
1130787817 15:87119744-87119766 ATGCTGATGTTCCCAGGCTTTGG + Intergenic
1133441246 16:5822778-5822800 ATGGTTAAGTGCATGGACTTTGG + Intergenic
1136029938 16:27495479-27495501 TTGCTTTAGTTCCCGGACTGGGG - Exonic
1136276983 16:29184667-29184689 AGGTTTGAGTTTCCGGACTTTGG + Intergenic
1137317540 16:47342431-47342453 ATCCTTAACTTCCTGAACTTAGG - Intronic
1148367310 17:47065548-47065570 CTGTTTAAGTTCCCGGCCATTGG + Intergenic
1150460329 17:65345205-65345227 AGGCTTAAATTCCACGACTTGGG - Intergenic
1153591709 18:6681041-6681063 ATGGTTAAGTATCAGGACTTGGG - Intergenic
1158899794 18:61951997-61952019 ATGCTACAGTTCCTGGACTAAGG + Intergenic
1166040322 19:40198419-40198441 GTGCTCAAGATCACGGACTTCGG + Exonic
926541772 2:14189400-14189422 ATTCTTAAGTGCCTGCACTTTGG - Intergenic
926817403 2:16813639-16813661 ATGCTCAAGTTCCAGGGTTTAGG + Intergenic
928469161 2:31556372-31556394 ATTCATAAGTTCCTGGAATTAGG - Intronic
935815833 2:106844967-106844989 TTGCTTAAGTTCCTGAAGTTAGG - Intronic
942550338 2:177109110-177109132 ATGCTCAAGTTCACTGAGTTCGG - Intergenic
947349808 2:229231702-229231724 ATGCTGGAGTTCCCAAACTTTGG + Intronic
948806291 2:240454654-240454676 ATGCCTAAGGTACCGGAATTTGG - Intronic
1169936821 20:10892594-10892616 ATCCTTAAATTCCTGGACTCAGG + Intergenic
1173698974 20:45049698-45049720 ATGCTTGAGTTCCTGGTATTCGG + Intronic
1177736300 21:25094326-25094348 AAATTTAAGTTCCAGGACTTAGG + Intergenic
1179593803 21:42428918-42428940 ATGCACAAGTTCCCGGGATTAGG - Intronic
957760911 3:84555227-84555249 ATGCTTTATTTCCTGGAGTTTGG + Intergenic
960143362 3:114172665-114172687 ATGCATAAGGTCCCAGAGTTAGG - Intronic
962839374 3:139220205-139220227 ATGCTTTAATTCCTTGACTTGGG + Intronic
964020093 3:151999615-151999637 ATGCATAGGTTCCAGGAATTAGG - Intergenic
967434086 3:189424548-189424570 ATGCTGATGTTGCCGGACTAGGG - Intergenic
967684345 3:192402073-192402095 ATGATTAAGTACCTGGACTTCGG - Intronic
972864884 4:43219702-43219724 ATACTTATGTTCCAGGAGTTGGG - Intergenic
978689069 4:111484593-111484615 ATTCTTAACTTCCTTGACTTGGG - Intergenic
979318931 4:119300575-119300597 ATGCTTAAGTTCCCGGACTTTGG + Exonic
979632724 4:122922112-122922134 ATGGTGAAGATCCCGGACTTTGG - Intronic
981296237 4:143135121-143135143 ATGGTTGAGTGCCCAGACTTTGG + Intergenic
992124552 5:73626715-73626737 ATGCTTCAGCTCCGGGACTGAGG + Intronic
996918024 5:128734126-128734148 ATATTTTAGTTTCCGGACTTGGG - Intronic
997320467 5:132973965-132973987 ATGCCTAAATCCCAGGACTTTGG + Intergenic
999602097 5:153278325-153278347 ATGCTTAAATTACAGGACATGGG + Intergenic
999756554 5:154668937-154668959 ATTCTTAAGTTCCAGGAATTAGG + Intergenic
999923219 5:156345563-156345585 ATGCTTAAATTCCAGGACTTTGG + Intronic
1006906173 6:37535339-37535361 ATGCCTAATTTCCCGGACCCAGG - Intergenic
1013420264 6:109960824-109960846 ATGATTAAGTTCCCTGAGATAGG + Intergenic
1022291118 7:29004581-29004603 ATGGTTAAGAGCACGGACTTGGG + Intronic
1026553231 7:71385520-71385542 ATTCTTCAGTTCCAGGGCTTGGG + Intronic
1031117866 7:117687774-117687796 AGGCTCAACTTCCCGGGCTTAGG + Intronic
1045081971 8:98635503-98635525 ATGATTAAGATCATGGACTTTGG - Intronic
1046026406 8:108729491-108729513 ATTCATAAGTTCCAGGAATTAGG + Intronic
1046251618 8:111639723-111639745 ATGGTTAAGTTCCAGGTCTTCGG + Intergenic
1048873564 8:138818291-138818313 TTGTTTAAGTTCCCTGTCTTGGG - Intronic
1055535186 9:77234475-77234497 ATGCCTATGGTCCCTGACTTAGG + Intronic
1055980987 9:82000319-82000341 ATTCTTAAGTTCCAGAAATTGGG - Intergenic
1059717628 9:116928310-116928332 ATGGTTAAATTGCTGGACTTTGG - Intronic
1059955416 9:119510673-119510695 ATGCTTAAGAGCACAGACTTTGG + Intronic
1193983769 X:88215507-88215529 ATTCTTAATTTCCAGGAATTAGG + Intergenic
1196331701 X:114478260-114478282 ATGCTGAAATTCCAGTACTTTGG + Intergenic