ID: 979318934

View in Genome Browser
Species Human (GRCh38)
Location 4:119300590-119300612
Sequence GACTTTGGTGTTCGCCGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979318926_979318934 25 Left 979318926 4:119300542-119300564 CCTGCAGCTTCGTAACAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG 0: 1
1: 0
2: 0
3: 0
4: 26
979318930_979318934 -2 Left 979318930 4:119300569-119300591 CCGAAAATGCTTAAGTTCCCGGA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG 0: 1
1: 0
2: 0
3: 0
4: 26
979318928_979318934 6 Left 979318928 4:119300561-119300583 CCTAGAAACCGAAAATGCTTAAG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG 0: 1
1: 0
2: 0
3: 0
4: 26
979318927_979318934 7 Left 979318927 4:119300560-119300582 CCCTAGAAACCGAAAATGCTTAA 0: 1
1: 0
2: 1
3: 11
4: 154
Right 979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979318934 Original CRISPR GACTTTGGTGTTCGCCGCAC CGG Exonic
923204186 1:231742049-231742071 GACTTTGGTGTTTACCCCAAGGG - Intronic
1072043709 10:91633746-91633768 GGCTTTAGTGTTCCCCGCAGGGG - Intergenic
1090416802 11:126546078-126546100 GACTGTGGTGTTTGGCACACAGG + Intronic
1091723195 12:2827932-2827954 GACTGTGGTGTGCTCGGCACAGG - Exonic
1096597147 12:52703127-52703149 GGCTTTGGGGTTGGCAGCACCGG - Exonic
1115346589 14:32349095-32349117 GACATTGGTGTTTGACGTACAGG + Intronic
1130907305 15:88249686-88249708 AGCTTTGGTGTTAGCCTCACTGG + Intronic
1131672219 15:94631881-94631903 GACTTCAGTGTTCCCAGCACTGG + Intergenic
1141830252 16:86506305-86506327 GCCTTTGGGGTTCGCGGCAGCGG + Intergenic
1141888577 16:86910627-86910649 GACTTGGGTGTTCTGCACACAGG - Intergenic
1151317059 17:73329463-73329485 GACCTTGCTGTGCGCCCCACTGG + Intergenic
1151366602 17:73621125-73621147 GAATTTGATGTTCCCCTCACTGG - Intronic
1160842560 19:1152735-1152757 GTCTGTGATGTTCGCCCCACAGG + Intronic
1162020068 19:7864287-7864309 GACTTTGGTTTCCGCTGCAGGGG - Intronic
940507353 2:154573233-154573255 GACTTTGGAGTTCACCACAGTGG - Intergenic
942117809 2:172746188-172746210 GACTTTGGTGTCAGCCAAACTGG + Intronic
1171968489 20:31548743-31548765 GTCTTTGGTGTTAGAAGCACAGG - Intronic
962807987 3:138940159-138940181 GGCTTGGGTGTTCGCTGCAACGG + Intergenic
965507302 3:169530599-169530621 CACTTGGGTGTCTGCCGCACTGG + Intronic
972402365 4:38717471-38717493 AACTTTGGTGTTCATCCCACTGG - Intergenic
979318934 4:119300590-119300612 GACTTTGGTGTTCGCCGCACCGG + Exonic
989978420 5:50612560-50612582 GCCTTTGGTGTTGGACTCACGGG - Intergenic
998162242 5:139820167-139820189 GAGTTTGGTGGTGGCGGCACGGG + Intronic
1000135886 5:158350423-158350445 GACTTTGGTGTTTGCCTATCTGG + Intergenic
1001603359 5:172943419-172943441 GACTTTGGTGTTCTCATCCCCGG + Intronic
1017000069 6:149990401-149990423 GACACCGGTGTTCGCCGCGCAGG + Intergenic
1022473687 7:30697137-30697159 GTCTTTGGTGTGAGCCGGACAGG + Intronic