ID: 979320408

View in Genome Browser
Species Human (GRCh38)
Location 4:119316649-119316671
Sequence CCACCCTGCTTGGCCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979320408_979320413 10 Left 979320408 4:119316649-119316671 CCTCTTTTGGCCAAGCAGGGTGG No data
Right 979320413 4:119316682-119316704 AGGTTGGTTTTCCCGAAAAACGG No data
979320408_979320412 -6 Left 979320408 4:119316649-119316671 CCTCTTTTGGCCAAGCAGGGTGG No data
Right 979320412 4:119316666-119316688 GGGTGGTGTAATGACAAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 122
979320408_979320411 -10 Left 979320408 4:119316649-119316671 CCTCTTTTGGCCAAGCAGGGTGG No data
Right 979320411 4:119316662-119316684 AGCAGGGTGGTGTAATGACAAGG No data
979320408_979320416 22 Left 979320408 4:119316649-119316671 CCTCTTTTGGCCAAGCAGGGTGG No data
Right 979320416 4:119316694-119316716 CCGAAAAACGGTTGTTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979320408 Original CRISPR CCACCCTGCTTGGCCAAAAG AGG (reversed) Intergenic
No off target data available for this crispr