ID: 979323833

View in Genome Browser
Species Human (GRCh38)
Location 4:119355746-119355768
Sequence AAAAGCTAATGAGGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979323833_979323836 0 Left 979323833 4:119355746-119355768 CCCAGATGGCCTCATTAGCTTTT 0: 2
1: 0
2: 2
3: 17
4: 175
Right 979323836 4:119355769-119355791 GCTTAGAAGTTCCAGTTATGAGG No data
979323833_979323839 22 Left 979323833 4:119355746-119355768 CCCAGATGGCCTCATTAGCTTTT 0: 2
1: 0
2: 2
3: 17
4: 175
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data
979323833_979323837 5 Left 979323833 4:119355746-119355768 CCCAGATGGCCTCATTAGCTTTT 0: 2
1: 0
2: 2
3: 17
4: 175
Right 979323837 4:119355774-119355796 GAAGTTCCAGTTATGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979323833 Original CRISPR AAAAGCTAATGAGGCCATCT GGG (reversed) Intergenic
904971092 1:34419977-34419999 AAAAGGATATGAGGCCCTCTTGG + Intergenic
905270595 1:36785127-36785149 AAACTCTAAAGAGGCCACCTTGG + Intergenic
906268301 1:44452256-44452278 AAAACCTTATGAGGCCAGCTGGG + Intronic
906608078 1:47184869-47184891 AAAAGCTAGTGAGGCAATGGGGG - Intronic
907848173 1:58228646-58228668 CAAAGCAAATGAGGCCAGCCTGG + Intronic
909555256 1:76946612-76946634 AAAAGCTCATAAGGCAATTTGGG - Intronic
909913745 1:81292443-81292465 AGAAGCTAATGAGGCATTTTAGG + Intergenic
909944280 1:81646104-81646126 CAAAGGTCATGAGGCCATATGGG - Intronic
915141047 1:153768843-153768865 AAAAGCTGAGGAGCCCATCCAGG + Intronic
917592996 1:176496616-176496638 ATAAGCTAAAGAGGAAATCTGGG - Intronic
920702637 1:208229447-208229469 AAAAGCAAATGAGCACACCTGGG - Intronic
920737968 1:208552574-208552596 AATAGCTAATGAGAACATCCAGG + Intergenic
921294100 1:213685968-213685990 AAGAGCTAATGAGGAACTCTAGG - Intergenic
921686434 1:218094380-218094402 AAGAGCTGATAAGGCCAACTTGG - Intergenic
1063165814 10:3461098-3461120 AAAAGCTAATGTTGCCATTTTGG - Intergenic
1065255546 10:23863386-23863408 AAGAGCTAATGAGGCTATGTGGG + Intronic
1070425272 10:76281190-76281212 AAAAGCCAAGGAGGTCATCTTGG + Intronic
1071753504 10:88509173-88509195 AAAAAGTGATGAGTCCATCTAGG - Intronic
1072796691 10:98361486-98361508 GAAAGTGAATGAGGCCAGCTGGG + Intergenic
1073194350 10:101676241-101676263 AGAGGCTAATGGGGCTATCTTGG - Intronic
1073554559 10:104436326-104436348 AGAAGCTACTGAGGGCTTCTTGG - Intronic
1079838316 11:25363607-25363629 AAAAGCTAATGAGACCTCCTAGG + Intergenic
1081038920 11:38185726-38185748 AAGAGCTAATTAGGCCATAAGGG - Intergenic
1081541066 11:44034942-44034964 AAAAGCTAAAGTGGCTATCCAGG + Intergenic
1083753297 11:64774975-64774997 AAAAGATATTGAGGGCATCCTGG + Intronic
1085294730 11:75424722-75424744 ACAGGCTTATGAGGCCATCAGGG + Intronic
1085452706 11:76645072-76645094 TAAACCTAAGGAGGGCATCTTGG + Intergenic
1085882883 11:80488568-80488590 AAAAGGTAATAGGGCCCTCTAGG - Intergenic
1086265794 11:84996570-84996592 AAAAGATAAGTAGGCCACCTTGG - Intronic
1087223973 11:95577401-95577423 ACAAGTTACTGAAGCCATCTGGG - Intergenic
1088619453 11:111666912-111666934 AAAAGATAATGACTACATCTTGG - Intronic
1089489050 11:118870393-118870415 GAAAGCTGCTGAGGCCAGCTTGG + Intergenic
1090261722 11:125326136-125326158 AAAAGCTTATGATGACATCGAGG + Intronic
1091386728 12:100702-100724 AAAAGCACATAAGGCCAACTTGG + Intronic
1092088026 12:5780948-5780970 AAAAGATAAGAAAGCCATCTAGG + Intronic
1093042208 12:14395153-14395175 AAAAGCTAATGCAGACTTCTAGG - Intronic
1093509110 12:19904712-19904734 AAAAGAAAATGAGGTTATCTAGG + Intergenic
1095415131 12:41968294-41968316 AAAAGCTGATGAGGCCAGAACGG + Intergenic
1096130905 12:49158161-49158183 AAAAAAAAATGAGGCCAGCTGGG + Intergenic
1096361072 12:50987599-50987621 AAAAGCTTATGAGGATTTCTTGG - Exonic
1097663233 12:62453369-62453391 AAAGGAAAATGAGGTCATCTGGG - Intergenic
1098127133 12:67309284-67309306 AAAAGCCAGAGAAGCCATCTAGG - Intronic
1098496845 12:71145688-71145710 AAATGATAATGAGACCCTCTGGG + Intronic
1099209749 12:79769733-79769755 AAAATATCATGAGGTCATCTGGG - Intergenic
1100093763 12:91006190-91006212 AAAAAATAGAGAGGCCATCTTGG + Intergenic
1100649484 12:96569306-96569328 GAAAACTAATGATGCCACCTGGG + Intronic
1104154562 12:126118824-126118846 AAAAGTTAAAGAGGTCACCTGGG + Intergenic
1105304815 13:19160980-19161002 AAAAGCTGAGGACCCCATCTTGG - Intergenic
1105341701 13:19532303-19532325 AAAAGGTGATGAGGCCATGAGGG + Intronic
1106622819 13:31388029-31388051 AAAATACAATGAGGCCATGTAGG - Intergenic
1115528363 14:34303351-34303373 AAAAGCTAACTAGGCCAACTAGG - Intronic
1115529189 14:34311121-34311143 ACATGCTACTGAAGCCATCTTGG - Intronic
1116530888 14:45972125-45972147 AAAAGCCAAAGAGGCCTACTAGG - Intergenic
1117217272 14:53564537-53564559 ACACACTAGTGAGGCCATCTTGG - Intergenic
1118020835 14:61712365-61712387 AAGAGGTAATGAGGCCATTGTGG + Intronic
1118364240 14:65080735-65080757 AAGAGCTAATGTTGCCTTCTGGG - Intronic
1118459482 14:65975609-65975631 AACATGAAATGAGGCCATCTAGG - Intronic
1121214904 14:92240240-92240262 AAGGACTAATGAGGGCATCTGGG + Intergenic
1126678513 15:51182529-51182551 AGGAGCTGCTGAGGCCATCTTGG - Intergenic
1127808953 15:62546648-62546670 AGTAGTTCATGAGGCCATCTTGG + Intronic
1128403746 15:67313851-67313873 AATAACTAATGAGGACATCAAGG - Intronic
1128991166 15:72261571-72261593 AAAAGATGCTGAGGCCAGCTCGG + Exonic
1129079359 15:73025490-73025512 AAAAGGTGATGAGGCTCTCTCGG - Intergenic
1129307580 15:74678474-74678496 AAAAGCCAGTAAAGCCATCTAGG - Intronic
1132027585 15:98416419-98416441 AACTGGGAATGAGGCCATCTCGG - Intergenic
1132248068 15:100312673-100312695 AAAACCAAATGAGGCAATCAGGG + Intronic
1135882795 16:26275500-26275522 AAAAGCTAATTGGCCCATATGGG - Intergenic
1140785695 16:78339924-78339946 AAATACTTATGAGGCCATCTGGG - Intronic
1140953406 16:79840155-79840177 AAAAGCTGATGAGGCCTTAAAGG - Intergenic
1141578215 16:84978947-84978969 AATAGCGATTGAGGACATCTGGG + Intronic
1143648272 17:8246555-8246577 AGGAGCTAAGGAGGACATCTAGG - Intronic
1146472891 17:33138773-33138795 AAATGCTAATGCCTCCATCTGGG + Intronic
1146699636 17:34945204-34945226 ATGAGTTAATGAGACCATCTGGG - Intronic
1146774720 17:35603574-35603596 AAAAGGGAATCAGGACATCTTGG + Intronic
1151196886 17:72438092-72438114 AAAAGTTTATGAGCCCATCGGGG + Intergenic
1151204326 17:72494743-72494765 AAAAGATGCTGAAGCCATCTGGG + Intergenic
1153271594 18:3327682-3327704 AAAAGCCAATGAAGAGATCTAGG + Intergenic
1153849186 18:9077451-9077473 GAAAACTGATGAGACCATCTCGG + Intergenic
1155721371 18:29016676-29016698 AAGAGTTAGTGATGCCATCTAGG + Intergenic
1156248770 18:35330515-35330537 AAAAACAAATGAGGCAAACTTGG - Intergenic
1156558920 18:38099413-38099435 AAAACATAATGAGGCTTTCTGGG + Intergenic
1161444179 19:4308862-4308884 AAAAGAGATTGAGACCATCTTGG + Intronic
1166808606 19:45501666-45501688 GAAAGGTAATGAAGCCAACTCGG - Intronic
925256506 2:2493872-2493894 GGAAGCTAATCTGGCCATCTTGG - Intergenic
926080108 2:9978223-9978245 AAAAGCTACTTAGTCCAACTTGG + Intronic
927102317 2:19797514-19797536 CAAAGCAAATGAGGGCATCTTGG + Intergenic
927175382 2:20402431-20402453 CAAAGCTGAAGGGGCCATCTTGG + Intergenic
927804652 2:26135999-26136021 AACAGCAAATGAAGGCATCTGGG - Exonic
930168753 2:48230181-48230203 AATAGCTAAAGAGGTCATGTTGG + Intergenic
935087563 2:99862922-99862944 ATAATCTAATGATGCTATCTTGG + Intronic
935869122 2:107426247-107426269 AAGAGGTGATGAGGTCATCTGGG - Intergenic
936961049 2:118075011-118075033 ACAATTTAATGAAGCCATCTGGG - Intergenic
936981500 2:118269373-118269395 AAGGGCTACTGTGGCCATCTTGG + Intergenic
938293628 2:130163304-130163326 AAAAGCTGAGGACCCCATCTTGG - Intronic
938462923 2:131509655-131509677 AAAAGCTGAGGACCCCATCTTGG + Intergenic
938560016 2:132463856-132463878 ACAAGTGAATGAGCCCATCTCGG - Intronic
939935282 2:148284426-148284448 AACAGATAATGAGGGCATCAGGG + Intronic
942059684 2:172216627-172216649 AAAAACTAATGAGCCTTTCTGGG - Intergenic
942945282 2:181665587-181665609 ACATGCAAATGAAGCCATCTTGG - Intronic
943592684 2:189818114-189818136 CAAAGCTCATGAGGAGATCTTGG - Exonic
944085528 2:195843628-195843650 AAAATCTGATGAGACCACCTAGG - Intronic
944911103 2:204311156-204311178 ACCAACTAATGAGGCCAGCTGGG + Intergenic
945007020 2:205419504-205419526 AAAAACTGAAGAGGCCAACTAGG + Intronic
945671762 2:212810605-212810627 ACATGATAATGAGGCCACCTTGG + Intergenic
1169470016 20:5877176-5877198 AAATGCAAACAAGGCCATCTTGG - Intergenic
1169875946 20:10297217-10297239 ACAAGTGAATGGGGCCATCTTGG - Intronic
1170170737 20:13408603-13408625 AAATGCCAGTGATGCCATCTGGG + Intronic
1170950647 20:20932890-20932912 AGATGCTGATAAGGCCATCTGGG - Intergenic
1171070587 20:22064540-22064562 GAAAGATAATCAGGCCATCAAGG - Intergenic
1173506011 20:43587702-43587724 AAAAGCTAATAAGGCCACCCAGG - Intronic
1174561156 20:51431791-51431813 AAAAGCAAATGAGGGCAACCCGG - Intronic
1185296953 22:50059047-50059069 AAAACCAAATGAAGACATCTAGG - Intergenic
949301194 3:2585886-2585908 AAAAGCTAATGAGGCTAGCTAGG + Intronic
949756617 3:7418746-7418768 AAAAGAGATTGAGGCCATCTTGG + Intronic
953773815 3:45798853-45798875 ATAGGCTAATTGGGCCATCTAGG + Intergenic
957144774 3:76410181-76410203 AAAAGCCAATGAGGCCCTAAGGG + Intronic
957340638 3:78891947-78891969 AAAAACTAATGAGGAAATTTTGG + Intronic
957412509 3:79859723-79859745 CAAAGCTAATGATGCCACCTGGG + Intergenic
957912153 3:86634164-86634186 AAAATTTAATAAGGCCTTCTGGG - Intergenic
958921265 3:100108488-100108510 AGAAGCCAGTGATGCCATCTGGG + Intronic
959094329 3:101936816-101936838 AAAAGGAAATGAGTCCATATTGG + Intergenic
959600437 3:108177252-108177274 GGAAGATAATGAAGCCATCTGGG - Intronic
960230218 3:115217265-115217287 AAAAGCTAATGAGTCTATCTGGG - Intergenic
961074078 3:123965417-123965439 AAATGCTAATGAGCACATTTTGG + Intergenic
961309547 3:125986715-125986737 AAATGCTAATGAGCACATTTTGG - Intergenic
963648462 3:147946420-147946442 AAAAGCTAAGCAAGCCATGTGGG + Intergenic
966839174 3:184074772-184074794 AAAAACAAAAGATGCCATCTAGG + Intergenic
969465631 4:7354603-7354625 AAAAGCACCAGAGGCCATCTGGG + Intronic
969550924 4:7866743-7866765 AACAGCAAATGAGGCCAGGTGGG + Intronic
974767292 4:66363395-66363417 AAAAGCTGCTGTAGCCATCTTGG + Intergenic
979323833 4:119355746-119355768 AAAAGCTAATGAGGCCATCTGGG - Intergenic
980291805 4:130854396-130854418 AATAGCAATTGAGACCATCTTGG + Intergenic
983241671 4:165240420-165240442 AAAAGCTAATGAGGCCATCTGGG - Intronic
985188491 4:187345341-187345363 AATAGCTAATCTGGCCATATGGG - Intergenic
986377010 5:7142609-7142631 AAAATCAAATGAGGCAATGTGGG - Intergenic
987170375 5:15250448-15250470 AAAAGCTAAAGAGGCAAAGTGGG + Intergenic
987501395 5:18714488-18714510 AAAAGCTATGAAGGACATCTTGG - Intergenic
991611534 5:68454634-68454656 AAGAGATAATTAGGCCATCATGG - Intergenic
995135057 5:108671996-108672018 AAAATGAAATGAGGACATCTGGG - Intergenic
996604403 5:125304214-125304236 ACATACAAATGAGGCCATCTGGG - Intergenic
997437364 5:133885173-133885195 GCAAGCTGAGGAGGCCATCTTGG - Intergenic
998924793 5:147110600-147110622 AAAAGTGCATGATGCCATCTTGG + Intergenic
999757530 5:154676061-154676083 TGAAGATCATGAGGCCATCTTGG - Intergenic
1004254438 6:14050038-14050060 ACAAGCTTATGGGGCCACCTTGG + Intergenic
1006642205 6:35495384-35495406 TAATGCTAATGAGCGCATCTGGG - Intronic
1007100561 6:39243415-39243437 CAAAGATAATGAGCTCATCTAGG + Intergenic
1007888305 6:45257772-45257794 AAGAGGTGATGAGGCCATCAGGG - Intronic
1008443115 6:51555678-51555700 AAAACCCAATGAAGCCTTCTAGG - Intergenic
1008925597 6:56888908-56888930 AAAATCTAATGAGTACATCTGGG + Intronic
1009801343 6:68540541-68540563 AAAAGGTAATTTGGCCATCAGGG - Intergenic
1009902849 6:69830187-69830209 AAAAGGAAATGATGCTATCTTGG + Intergenic
1010595339 6:77756018-77756040 AAAAGATAATGAAGCCATGCTGG - Intronic
1010726006 6:79334158-79334180 AAATACAAATGAGGCCAGCTTGG + Intergenic
1011375844 6:86686116-86686138 TTTAGCTAATGATGCCATCTTGG - Intergenic
1014570793 6:123005279-123005301 TAAAGCTGATGAAGCCTTCTAGG - Intronic
1014928183 6:127300019-127300041 CAAACCTAATGATACCATCTAGG - Intronic
1015169316 6:130233504-130233526 AAAAGCAAATGAGGTCATCAAGG + Intronic
1016811921 6:148269660-148269682 AAAATCAAATGAGGCCATCAGGG - Intergenic
1018104664 6:160472369-160472391 AATTTCTAATGAAGCCATCTGGG + Intergenic
1019833344 7:3356096-3356118 AAAAGCTAATGAGGCTGACATGG - Intronic
1021268492 7:18554762-18554784 GAAAGCTCATGAGGGCTTCTTGG - Intronic
1022692483 7:32670462-32670484 AAAAGCTAATGAGGTATTTTGGG + Intergenic
1022872808 7:34497232-34497254 AGAAGCTAAAGAGGTCCTCTTGG + Intergenic
1023142313 7:37113734-37113756 AAAATCAAATGAGGCCATTAGGG + Intronic
1024233665 7:47381667-47381689 ATATGCCAATGTGGCCATCTCGG - Intronic
1026685764 7:72508645-72508667 CACACCTAACGAGGCCATCTAGG - Intergenic
1027694810 7:81397566-81397588 AACAGCTAATGTGATCATCTTGG - Intergenic
1027799737 7:82736137-82736159 AAAATCTAAAGAGGCCCACTAGG - Intergenic
1028979061 7:96946670-96946692 GAAAGCAAATGAGGTCATTTTGG - Intergenic
1033420478 7:141200654-141200676 AAAAGGGAATGAGGTCAGCTTGG - Intronic
1036013363 8:4753207-4753229 AAAAGCAAATGAGCTCATCATGG - Intronic
1038411011 8:27359956-27359978 TAAAGCTATGGAGGCCACCTGGG - Intronic
1040031028 8:42823751-42823773 AAAATCTAAATAGGCCAACTAGG + Intergenic
1041699446 8:60772041-60772063 TAGAGATAATGGGGCCATCTTGG + Intronic
1041976827 8:63808780-63808802 AAAAGCTAATGAGTCAAATTTGG + Intergenic
1042326248 8:67531098-67531120 AAAAGGAAATGAGGAAATCTTGG + Intronic
1042749388 8:72141421-72141443 AAAAGGTGATGAGGCCATGAGGG - Intergenic
1045340421 8:101249604-101249626 AAATATTCATGAGGCCATCTAGG + Intergenic
1046588734 8:116180002-116180024 AAAAGGTAATGAGGCCATGAGGG + Intergenic
1046720524 8:117613622-117613644 ATATGCAAATGAGCCCATCTAGG - Intergenic
1047649480 8:126904414-126904436 AGAAGCAAATGAGGACATTTTGG + Intergenic
1048322806 8:133413944-133413966 ATAAGCTATATAGGCCATCTTGG - Intergenic
1048527678 8:135218214-135218236 AAAAACTCATAAGGCAATCTAGG - Intergenic
1048740447 8:137552932-137552954 AAAAGCTAATTAGCTCATATTGG - Intergenic
1049283621 8:141762963-141762985 AAAAACTAGTGAGGCCATCAAGG + Intergenic
1054749093 9:68886255-68886277 AAAAGATAAGGAGGCCATGCAGG - Intronic
1055850763 9:80626854-80626876 AAAAACCAATGGGGCCCTCTGGG + Intergenic
1056457670 9:86777860-86777882 ATTTGCTAATGAAGCCATCTGGG + Intergenic
1056534587 9:87516682-87516704 AAGAGCTAATTAAGCCATGTGGG - Intronic
1062688596 9:137828945-137828967 AGAGGCAAAAGAGGCCATCTGGG - Intronic
1186060847 X:5704951-5704973 AAAAGCTAAAGATACAATCTTGG - Intergenic
1186134246 X:6502339-6502361 AAAAGAAAATCAGGGCATCTTGG - Intergenic
1189282655 X:39829808-39829830 AAATGTGAATGAGGCCATCTGGG - Intergenic
1191737197 X:64399360-64399382 AAAAGGTAATTAGGCCATGAGGG - Intergenic
1201456834 Y:14177423-14177445 AAAAGATAATGGTGCCCTCTTGG + Intergenic
1201973278 Y:19818697-19818719 AAAAGATAATGGGGACTTCTTGG + Intergenic