ID: 979323834

View in Genome Browser
Species Human (GRCh38)
Location 4:119355747-119355769
Sequence CAAAAGCTAATGAGGCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979323834_979323837 4 Left 979323834 4:119355747-119355769 CCAGATGGCCTCATTAGCTTTTG 0: 2
1: 0
2: 2
3: 13
4: 132
Right 979323837 4:119355774-119355796 GAAGTTCCAGTTATGAGGTAAGG No data
979323834_979323839 21 Left 979323834 4:119355747-119355769 CCAGATGGCCTCATTAGCTTTTG 0: 2
1: 0
2: 2
3: 13
4: 132
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data
979323834_979323836 -1 Left 979323834 4:119355747-119355769 CCAGATGGCCTCATTAGCTTTTG 0: 2
1: 0
2: 2
3: 13
4: 132
Right 979323836 4:119355769-119355791 GCTTAGAAGTTCCAGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979323834 Original CRISPR CAAAAGCTAATGAGGCCATC TGG (reversed) Intergenic
900193264 1:1360323-1360345 AAAAGGCTGATGAGGCCATCAGG + Intronic
900208540 1:1441789-1441811 CAGAAGCCACTGAGGCCACCAGG - Exonic
900760846 1:4469203-4469225 CAAGTGCTGATGAGGCCACCTGG - Intergenic
902124868 1:14200927-14200949 CAAATACTAATGAGGCTGTCAGG - Intergenic
905899273 1:41570422-41570444 CAAACGCTTATGAAACCATCAGG - Intronic
906268300 1:44452255-44452277 AAAAACCTTATGAGGCCAGCTGG + Intronic
906608079 1:47184870-47184892 CAAAAGCTAGTGAGGCAATGGGG - Intronic
907129916 1:52087462-52087484 CAAAAGCTGACCAGGCCATTTGG - Exonic
908433684 1:64083649-64083671 GAAAAGCTACTGAGGCCAGAGGG + Intronic
910504955 1:87939888-87939910 CAAAAGTTTGAGAGGCCATCAGG - Intergenic
910742041 1:90530067-90530089 CAAAAGCCAATGTGGAAATCTGG - Intergenic
914420032 1:147520696-147520718 GAAAAGCTAATGAGGGCATATGG - Intergenic
914757630 1:150573388-150573410 CATATGCTAATCAGGCAATCAGG - Intergenic
914885274 1:151579523-151579545 GAAAAGCTAATGAAGTCATATGG + Intronic
915077809 1:153325486-153325508 GAAGAGCTAAATAGGCCATCAGG + Intergenic
915812839 1:158933962-158933984 GAAAAACTACTGAGGCCTTCAGG + Intronic
915897376 1:159822735-159822757 CAAAAGTTAAGGAGGCACTCAGG + Intergenic
916151190 1:161792846-161792868 CACAAGTGTATGAGGCCATCTGG - Intronic
916579472 1:166094731-166094753 GAAAAGATAAGGAGGACATCTGG + Intronic
918246008 1:182659920-182659942 CAAAAGCTCATGAGGCAAAGGGG + Intronic
919145868 1:193634168-193634190 CAAGAACTAATGAGGCTGTCAGG - Intergenic
923658985 1:235942306-235942328 CAGAAGCTTCTGGGGCCATCAGG - Intergenic
1063689600 10:8273715-8273737 TAAAAGGAAATGAGGACATCTGG - Intergenic
1065255545 10:23863385-23863407 TAAGAGCTAATGAGGCTATGTGG + Intronic
1065946495 10:30609666-30609688 CAACAGATAATGTGGCCATGGGG + Intergenic
1070974046 10:80590522-80590544 CAAAGGCTAGTGACGCGATCTGG + Intronic
1075553128 10:123408644-123408666 CAAAAACTAAACAGGCCATTGGG + Intergenic
1075912739 10:126139833-126139855 CAAAAGCTAAGGAGGTGACCTGG - Intronic
1079412630 11:20203387-20203409 CCAAAGCTAATCAGCCCATTTGG - Intergenic
1081038921 11:38185727-38185749 TAAGAGCTAATTAGGCCATAAGG - Intergenic
1081137967 11:39462636-39462658 AAAAAGCAAATGAGGCAATTAGG - Intergenic
1085294729 11:75424721-75424743 CACAGGCTTATGAGGCCATCAGG + Intronic
1086136672 11:83448823-83448845 CAAAAGCCAATGATAGCATCTGG - Intergenic
1091124064 11:133080984-133081006 CAAAAGCTAATAAGGCCTGGCGG - Intronic
1093945776 12:25107864-25107886 GAAAGGCTAATAAGGCCCTCTGG + Exonic
1095383851 12:41627434-41627456 AAACTGCTAATGATGCCATCAGG + Intergenic
1098496844 12:71145687-71145709 CAAATGATAATGAGACCCTCTGG + Intronic
1099209750 12:79769734-79769756 CAAAATATCATGAGGTCATCTGG - Intergenic
1102742703 12:115222452-115222474 CAAAAGCTTAGAAGTCCATCTGG + Intergenic
1105341700 13:19532302-19532324 TAAAAGGTGATGAGGCCATGAGG + Intronic
1106798895 13:33235658-33235680 CAAAAACTACTGAGGCCTTGAGG + Intronic
1108766146 13:53631729-53631751 CAATAGCTAATGAGGACGTGAGG - Intergenic
1109736177 13:66486783-66486805 CAAATACTAACGAGGCAATCTGG + Intronic
1110978073 13:81865731-81865753 CAAAAGGAAATGATCCCATCTGG + Intergenic
1111030217 13:82587526-82587548 GAAAAGCTAAGGAGACCATCTGG + Intergenic
1116558407 14:46343866-46343888 CAAAAGGCAAAGAGGCCAACGGG + Intergenic
1117668099 14:58078176-58078198 CAAAAGCTTATGAGCTCCTCTGG + Intronic
1118008711 14:61588644-61588666 CATAAGCTCCTGAGGCCATTAGG + Intronic
1119658854 14:76436529-76436551 CAAAACCTAAAGCAGCCATCAGG + Intronic
1121214903 14:92240239-92240261 CAAGGACTAATGAGGGCATCTGG + Intergenic
1124125456 15:26935027-26935049 CAAGAGTAAATGAGGCAATCAGG - Intronic
1126656062 15:50979307-50979329 AAAAAGCTGATCAGGCCATGAGG + Intronic
1126856085 15:52840755-52840777 AAAAAGCTAATGAGATGATCTGG + Intergenic
1129061675 15:72865385-72865407 CAAAAGGTAAGGAGTGCATCTGG - Intergenic
1130717632 15:86351321-86351343 CAAGAGGTAATAAGGCCATAAGG - Intronic
1131914662 15:97251822-97251844 CAAATGCTAATGAGAACACCCGG + Intergenic
1132072554 15:98791599-98791621 GAAAACCTAAGGAGGCCATTAGG + Intronic
1132248067 15:100312672-100312694 GAAAACCAAATGAGGCAATCAGG + Intronic
1132777420 16:1603007-1603029 CAAAAGCTATTAAGGCAATGGGG + Intronic
1135349808 16:21719167-21719189 CAAAAGCTCCTCAGGCCTTCTGG - Exonic
1140785696 16:78339925-78339947 AAAATACTTATGAGGCCATCTGG - Intronic
1141578214 16:84978946-84978968 CAATAGCGATTGAGGACATCTGG + Intronic
1143476757 17:7207554-7207576 CAAGAGCAAATGAGGGCAGCAGG + Intronic
1146472890 17:33138772-33138794 CAAATGCTAATGCCTCCATCTGG + Intronic
1146699637 17:34945205-34945227 CATGAGTTAATGAGACCATCTGG - Intronic
1148800439 17:50221666-50221688 CAGAGGCTCATGAGGCCCTCAGG - Intergenic
1150594795 17:66594418-66594440 CTAAAAATAAAGAGGCCATCTGG - Intronic
1151196885 17:72438091-72438113 CAAAAGTTTATGAGCCCATCGGG + Intergenic
1153694319 18:7625281-7625303 CAAAAGCAAATCAGGAAATCTGG - Intronic
1158742800 18:60163352-60163374 CTAAAACAAATTAGGCCATCAGG - Intergenic
1164887847 19:31798569-31798591 CAAAACCTAATATGGCCATCTGG + Intergenic
925439739 2:3874547-3874569 CAAAGGCTCATGATGCCAACTGG + Intergenic
926058341 2:9789752-9789774 CAAAAGCTCGTGAGGGCATGTGG + Intergenic
926295930 2:11568595-11568617 CAAACGCTAAGGTGGCCACCAGG - Intronic
926932156 2:18051339-18051361 CAAAAGCCTAAGAGGCCTTCAGG - Intronic
927840815 2:26442205-26442227 TAAGAGGTAATGAGGCCATAAGG - Intronic
930195996 2:48510815-48510837 GGAAAGATAATGAGGCCATATGG + Intronic
935024487 2:99263174-99263196 AAAAAGATAATGAGGTCATGAGG - Intronic
935531289 2:104235240-104235262 CACAAGCTAAGGAGGCCAAGAGG + Intergenic
939935281 2:148284425-148284447 CAACAGATAATGAGGGCATCAGG + Intronic
942059685 2:172216628-172216650 CAAAAACTAATGAGCCTTTCTGG - Intergenic
943345840 2:186735524-186735546 ATAAAGCTAATGAGATCATCGGG - Intronic
944911102 2:204311155-204311177 CACCAACTAATGAGGCCAGCTGG + Intergenic
946474792 2:219996742-219996764 CAGAAGGTAATAAGGCCATGTGG - Intergenic
947100530 2:226616477-226616499 CTAATGCAAAAGAGGCCATCTGG + Intergenic
947318212 2:228886620-228886642 TAAATGGTAATGAGGCAATCGGG + Intronic
1173134120 20:40424190-40424212 CAGAATCTCATGAGGTCATCAGG + Intergenic
1177157969 21:17517806-17517828 CAAAAGCTGACCAGGCCATTTGG + Intronic
1185423055 22:50745735-50745757 CAAAGGCTAAGGAGGCCACTAGG + Intergenic
950078953 3:10207554-10207576 TGAAGACTAATGAGGCCATCTGG - Intronic
955468272 3:59258789-59258811 CAATACCTAAAGTGGCCATCAGG - Intergenic
957144773 3:76410180-76410202 TAAAAGCCAATGAGGCCCTAAGG + Intronic
957334338 3:78807682-78807704 CAAAAGCTTATGAGAACATATGG + Intronic
957412508 3:79859722-79859744 GCAAAGCTAATGATGCCACCTGG + Intergenic
960230219 3:115217266-115217288 AAAAAGCTAATGAGTCTATCTGG - Intergenic
968090265 3:195894864-195894886 CAAAAGCAAACAAGGACATCTGG + Intronic
968435355 4:583718-583740 AAAAATCTAATGAGGGTATCTGG - Intergenic
968615871 4:1577540-1577562 CAAGTCCTAATTAGGCCATCCGG + Intergenic
969465630 4:7354602-7354624 CAAAAGCACCAGAGGCCATCTGG + Intronic
977282290 4:95056165-95056187 CAAGACCAAAAGAGGCCATCTGG - Intronic
978702556 4:111666029-111666051 CAAATGCTAAGGAGGCCATCTGG - Intergenic
979323834 4:119355747-119355769 CAAAAGCTAATGAGGCCATCTGG - Intergenic
980452404 4:132991718-132991740 CAAAAGATGATTAGGCCATGAGG + Intergenic
981769370 4:148289869-148289891 CAAAAGCTTATGAGGAAATGAGG + Intronic
983241672 4:165240421-165240443 CAAAAGCTAATGAGGCCATCTGG - Intronic
985188492 4:187345342-187345364 CAATAGCTAATCTGGCCATATGG - Intergenic
987950854 5:24673990-24674012 CAAAAGCAAATGAGGACTTTAGG + Intergenic
989187831 5:38642221-38642243 AAAAAGCAAAGGAGGCCCTCAGG + Intergenic
992205789 5:74429332-74429354 CAGTAGCTGCTGAGGCCATCTGG - Intergenic
995511578 5:112915677-112915699 CACAAGCCAATGTGGCCTTCTGG - Intronic
995752968 5:115472863-115472885 CCAAAGCTAAAGAGGCCACAGGG - Intergenic
997351036 5:133231465-133231487 CAAAAGCAAAAGAGGATATCAGG - Intronic
1003260730 6:4513186-4513208 CAAAGGCTTTCGAGGCCATCAGG + Intergenic
1004776813 6:18856780-18856802 CAAAAGCTAGTGCGGTCTTCTGG + Intergenic
1006000905 6:30964404-30964426 CCACAGCTTATGAGACCATCAGG + Intergenic
1007888306 6:45257773-45257795 TAAGAGGTGATGAGGCCATCAGG - Intronic
1008925596 6:56888907-56888929 GAAAATCTAATGAGTACATCTGG + Intronic
1009538235 6:64918728-64918750 GGAAAGATAATGATGCCATCAGG + Intronic
1009694432 6:67082665-67082687 CAAAGGCAAATGAGGAAATCTGG - Intergenic
1009801344 6:68540542-68540564 TAAAAGGTAATTTGGCCATCAGG - Intergenic
1012043990 6:94245682-94245704 TAAAAGCTGATTAGGCCATAAGG - Intergenic
1015736344 6:136403905-136403927 CAAAAGCTCATGAGGCTGTCAGG - Intronic
1016811922 6:148269661-148269683 TAAAATCAAATGAGGCCATCAGG - Intergenic
1023142312 7:37113733-37113755 TAAAATCAAATGAGGCCATTAGG + Intronic
1028864635 7:95693383-95693405 CTACAGCTAATGAGGCTATGAGG + Intergenic
1032264495 7:130361611-130361633 CATTTGCTAATGAGGTCATCTGG + Intronic
1034076762 7:148239540-148239562 CAAAAGCTAATGAGGTCATGAGG - Intronic
1034350923 7:150414199-150414221 AAAAAGCTAAGGAGGCCTTAAGG - Intergenic
1035392518 7:158514721-158514743 CTTAAGCTAATGAGGTCATTTGG + Intronic
1038411012 8:27359957-27359979 CTAAAGCTATGGAGGCCACCTGG - Intronic
1041520308 8:58748497-58748519 CAAATGTTTATGTGGCCATCAGG + Intergenic
1042749389 8:72141422-72141444 AAAAAGGTGATGAGGCCATGAGG - Intergenic
1044075270 8:87813700-87813722 CAGAACCAAATGAGGCCATGGGG + Intergenic
1046588733 8:116180001-116180023 TAAAAGGTAATGAGGCCATGAGG + Intergenic
1047227924 8:122972195-122972217 CAAGTGAGAATGAGGCCATCAGG - Intronic
1049170810 8:141159524-141159546 CAGGAGATAATGAGGACATCAGG - Intronic
1050284809 9:4090200-4090222 CAAAAGATAATGAGGACAGTGGG - Intronic
1052979824 9:34440025-34440047 CAAAACAGAATGAGGCCCTCTGG + Intronic
1053029877 9:34766479-34766501 CAGGAGCTGATGAGACCATCTGG - Intergenic
1053325407 9:37142620-37142642 CAACAGCTAATTAGACTATCAGG - Intronic
1054973707 9:71118578-71118600 CTAAATCTAATCAAGCCATCAGG + Intronic
1060432342 9:123561252-123561274 AAAATGGTAATGAGGCCATTAGG - Intronic
1061548622 9:131319559-131319581 CGAAAACTCATGAAGCCATCAGG + Intergenic
1061723786 9:132570342-132570364 CAAAAGCTACTGAGCCCCTCAGG - Intronic
1061823450 9:133241486-133241508 CAAAAGATACTGATGCCAGCCGG + Intergenic
1062688597 9:137828946-137828968 CAGAGGCAAAAGAGGCCATCTGG - Intronic
1189282656 X:39829809-39829831 AAAATGTGAATGAGGCCATCTGG - Intergenic
1191737198 X:64399361-64399383 TAAAAGGTAATTAGGCCATGAGG - Intergenic
1195835727 X:109112959-109112981 CAAAAGCAAAGGAGTCCATGAGG - Intergenic