ID: 979323835

View in Genome Browser
Species Human (GRCh38)
Location 4:119355755-119355777
Sequence CTTCTAAGCAAAAGCTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979323835_979323839 13 Left 979323835 4:119355755-119355777 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data
979323835_979323840 23 Left 979323835 4:119355755-119355777 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 979323840 4:119355801-119355823 TGAAAAACCTTGGTCAATATTGG No data
979323835_979323836 -9 Left 979323835 4:119355755-119355777 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 979323836 4:119355769-119355791 GCTTAGAAGTTCCAGTTATGAGG No data
979323835_979323837 -4 Left 979323835 4:119355755-119355777 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 979323837 4:119355774-119355796 GAAGTTCCAGTTATGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979323835 Original CRISPR CTTCTAAGCAAAAGCTAATG AGG (reversed) Intergenic
903745022 1:25581128-25581150 CTTCTCACCAAAAGCAAATGGGG + Intergenic
906422860 1:45685990-45686012 CTTCAAAGGAAAACCTAAGGAGG - Intronic
906423928 1:45693529-45693551 CATCTGAGTAAAAGCTAATATGG - Exonic
907617906 1:55943533-55943555 CTTCAAAAATAAAGCTAATGGGG - Intergenic
911459301 1:98169395-98169417 GTTCAAAGCAACAGGTAATGTGG - Intergenic
911694204 1:100870141-100870163 CTTCTGAGCTAGAGCTAAAGTGG + Intergenic
911808515 1:102243165-102243187 ATTCGAAGCAAAAGGTGATGAGG + Intergenic
911971268 1:104440856-104440878 CTGCCAAGCAAAAGGTATTGAGG + Intergenic
912770369 1:112458407-112458429 CATTTAAGCAAAAGTTAATTTGG - Exonic
915244886 1:154549644-154549666 TTTCTAAGAAAAAGAAAATGAGG - Exonic
915535571 1:156533492-156533514 CTTCTCAGAGAAACCTAATGAGG + Intronic
915588342 1:156857281-156857303 CTTCCAGGCAAAAGCCAATCAGG + Intronic
915822080 1:159034915-159034937 CTGCTGAGCAAAAGGTAATCTGG - Intronic
918640069 1:186829097-186829119 CTACCAAGTAAAAGCTAAGGAGG - Intronic
919270969 1:195344388-195344410 CTTCTAAGACAAAAATAATGAGG + Intergenic
921141172 1:212308204-212308226 CTTCTTAGCAAAAACAACTGAGG - Intronic
923683866 1:236141230-236141252 ATTCTGAGCAAAAGCTAGGGTGG + Intergenic
1063221310 10:3970843-3970865 ATTCCCAGCAAAAGATAATGTGG + Intergenic
1063883019 10:10550558-10550580 TTTATAAGCATAAGGTAATGAGG + Intergenic
1068364920 10:56035599-56035621 CTTCTGTGCAAAAGTCAATGAGG + Intergenic
1068654181 10:59557662-59557684 CTTCTCAACACCAGCTAATGAGG + Intergenic
1073526175 10:104184300-104184322 AATCTAAGCAAAATCTAATTAGG + Intronic
1073841726 10:107505519-107505541 CTTATATGCAAAAGCCAATTTGG - Intergenic
1074418196 10:113285729-113285751 CTTCTAAGCCCAGGCTAGTGAGG + Intergenic
1074933047 10:118148558-118148580 CTTCTAATCAAGAGCTAAACTGG - Intergenic
1075532485 10:123241468-123241490 CATCTGAAAAAAAGCTAATGAGG - Intergenic
1077428442 11:2499543-2499565 CTTGTAAGCAACAGATAATTGGG - Intronic
1078143699 11:8709127-8709149 CTGCTAAGCAAATGCAGATGGGG + Intronic
1078756585 11:14216470-14216492 CTCCTTAGAAATAGCTAATGAGG + Intronic
1078948316 11:16097259-16097281 TTTATATGCAAAAGCTAATCTGG + Intronic
1080280833 11:30554799-30554821 CTTCTAACCCAAAGAAAATGTGG - Intronic
1085852235 11:80135229-80135251 ATATTAAGCAAAAGATAATGGGG - Intergenic
1086749308 11:90470769-90470791 CTTCTAATCAAAGCTTAATGTGG + Intergenic
1088769240 11:113016448-113016470 CTGCTAAGCAAAAGCTGCTTGGG - Intronic
1089424827 11:118363917-118363939 CATATCAACAAAAGCTAATGTGG - Intronic
1089451696 11:118602644-118602666 CTTCTCAGAAAAACCTCATGTGG - Exonic
1089946734 11:122482268-122482290 CTTCTAAGCAACAGATCATTGGG - Intergenic
1090653602 11:128826074-128826096 CCTCCAAGCCACAGCTAATGCGG + Intergenic
1091124067 11:133080992-133081014 CCTCTCACCAAAAGCTAATAAGG - Intronic
1092974789 12:13734257-13734279 AATCTAGGCACAAGCTAATGAGG + Intronic
1094467629 12:30770509-30770531 CTTCCAAGCAACAGATACTGTGG - Intergenic
1095684293 12:45014765-45014787 CTTTTAAGTAAAAGATCATGTGG + Exonic
1097780532 12:63698440-63698462 ATTCAAAGCAAAAGTTAATGAGG + Intergenic
1098287155 12:68918931-68918953 CTTCTAAGCCAATTCTAAAGTGG - Intronic
1099618428 12:84970145-84970167 ATTATAAACAAAAACTAATGGGG + Intergenic
1099952996 12:89324743-89324765 TTTTTAAGCAAAAACCAATGGGG + Intergenic
1102517227 12:113457837-113457859 GTTTTAAGCAAAAGCCAATGAGG + Intergenic
1102521228 12:113478584-113478606 CTTCTAAACAAAGGCTAATGAGG - Intergenic
1102791579 12:115650607-115650629 CTTCACATCAAAATCTAATGGGG + Intergenic
1103210254 12:119160455-119160477 CTTGGAAGCAGAAGGTAATGAGG - Exonic
1105624335 13:22098569-22098591 CTTCAATGCAAAAGCTCCTGTGG - Intergenic
1105624429 13:22099253-22099275 CTTCAATGCAAAAGCTTTTGTGG + Intergenic
1106193284 13:27472781-27472803 TTTATAAGCACAAGGTAATGAGG + Intergenic
1106374832 13:29176248-29176270 CTCCTAACCAAGAGCCAATGGGG - Intronic
1107387772 13:39931227-39931249 ATTCCAAGCAAAAACCAATGTGG + Intergenic
1108099481 13:46938930-46938952 CTTCTAGGCAACAGATAATTGGG - Intergenic
1108131237 13:47302730-47302752 CTTCAAAGGAAAATGTAATGTGG + Intergenic
1108284652 13:48894599-48894621 CTTCAAATGAAAAGCTTATGAGG - Intergenic
1108746716 13:53403324-53403346 ATCCTACACAAAAGCTAATGGGG - Intergenic
1110387646 13:74932895-74932917 CTTCTAGGTCAAAGCTACTGTGG - Intergenic
1114828810 14:26113159-26113181 GTTTTAAGCAAAAAGTAATGTGG + Intergenic
1116330738 14:43594723-43594745 CTTCTATGCCGAAGCTGATGAGG + Intergenic
1118906118 14:70024605-70024627 GTTCTAAGCCAAGGCAAATGAGG + Intronic
1119082740 14:71711150-71711172 CTTCCAAGCAAAAGGAAATTGGG + Intronic
1119627686 14:76194853-76194875 GTTTTAATCAACAGCTAATGAGG + Intronic
1120516541 14:85477547-85477569 CTTCTAACAAAGAGCAAATGTGG + Intergenic
1126692511 15:51298785-51298807 CTCCTCAGCAGTAGCTAATGTGG - Intronic
1127123479 15:55790752-55790774 CTTCACAGCAACAGCTAATTTGG + Intergenic
1127801511 15:62481285-62481307 CTTCTCACAAAAAGCAAATGTGG - Intronic
1128959592 15:71988303-71988325 CTTTTAATCAAAAGCTAAGCTGG - Intronic
1134817095 16:17214660-17214682 CTCATAAGCAAAAGCTCTTGTGG - Intronic
1135070102 16:19344469-19344491 CCTGTAAGCAAAGACTAATGGGG - Intergenic
1140054892 16:71516905-71516927 AATCTAAGCAAAAGATAAAGAGG - Intronic
1140651791 16:77096293-77096315 TTTTTAAGCTAAAGCTGATGAGG - Intergenic
1141382856 16:83591301-83591323 CTAGAAAACAAAAGCTAATGTGG + Intronic
1146352347 17:32105248-32105270 CATCTTAGGAAAAGCTAGTGTGG + Intergenic
1150758471 17:67937804-67937826 CATCTTAGGAAAAGCTAGTGTGG - Intronic
1153846880 18:9058112-9058134 TTTATAAGCAAAGGGTAATGAGG - Intergenic
1154100551 18:11469047-11469069 CTTCTAATCAATTGCTAATGGGG - Intergenic
1155175105 18:23294881-23294903 CTTCTCAGCCAAAGCTTTTGGGG + Intronic
1156002005 18:32395565-32395587 CTTTTATGCAAAAGGCAATGAGG + Intronic
1157195457 18:45617150-45617172 CTTCCAAACACAAGCTAAGGAGG + Intronic
1159332108 18:67009245-67009267 CTTCTAATCAAAAGCTAGAAAGG - Intergenic
1165686112 19:37821490-37821512 CTTCCAGGCAACAGCGAATGAGG - Intergenic
925114851 2:1369894-1369916 GTTTTAATCAAAAGGTAATGGGG + Intergenic
926329940 2:11815946-11815968 TCTCAAAGCAAAAGCTATTGTGG + Intronic
926422276 2:12711881-12711903 CTTCAAAGCAAAGGATCATGTGG + Intergenic
927534423 2:23842869-23842891 CTCCTAAGAAAAAGGAAATGTGG + Intronic
930016524 2:46974664-46974686 TTTCTAAGCGAAAGAGAATGAGG - Intronic
930259626 2:49130137-49130159 TTTCTCAGAAAAAGCTACTGAGG - Intronic
931647329 2:64436420-64436442 TTGCAAGGCAAAAGCTAATGTGG - Intergenic
932531104 2:72533568-72533590 TTTCTAAGCCAAAACCAATGTGG + Intronic
933534181 2:83551869-83551891 CTTTTATGTAAAAGCTGATGGGG - Intergenic
936961813 2:118083422-118083444 CCTCTAAGACAAAGCTACTGAGG - Intergenic
940000989 2:148965949-148965971 CTTCAGAGCAGAAGATAATGAGG + Intronic
940294543 2:152108895-152108917 CATCTAAGCAGAAGCTTAAGAGG - Intergenic
940338427 2:152553597-152553619 CATCTAAACAAAAGCTTATTGGG - Intronic
946791313 2:223303226-223303248 TTTCCAAGAAAAAGCTACTGTGG + Intergenic
948493800 2:238331935-238331957 CTTCTTCGCAAAAGCCCATGAGG - Intronic
1169526122 20:6427744-6427766 CTACTAAGAAATGGCTAATGAGG + Intergenic
1170592483 20:17781417-17781439 TTTATAAGCATAAGGTAATGAGG - Intergenic
1174185993 20:48706789-48706811 CTTTTAAGCAAAAAGGAATGAGG + Intronic
1178096931 21:29225762-29225784 CTTCTAAGGAAGAGCTTATGTGG + Intronic
1180408826 22:12583702-12583724 CTTCTCAGCAAAATATAAAGGGG + Intergenic
1181676849 22:24460310-24460332 CCTCTAAGGAAAAGGAAATGGGG + Intergenic
1181773419 22:25143031-25143053 CTTCTAAACAAAGGCTGATGAGG + Intronic
1183088646 22:35505644-35505666 CTTCTAAGTAAAAGGGCATGGGG - Intergenic
1185203004 22:49519973-49519995 CTTCTAAGAAAAATGTAAAGAGG + Intronic
951287780 3:20836327-20836349 CTTCTCACCAACAGCTAATGAGG - Intergenic
952067385 3:29587410-29587432 CTCCTAAGCCAAACCTAATGTGG - Intronic
952426905 3:33184991-33185013 GTTCTGAGCAAAAGCCACTGTGG + Intronic
955821274 3:62898534-62898556 TTTCTAAGAAAAAGCTACTATGG - Intergenic
956412655 3:68994829-68994851 CTTCTCAGCACAAGCAAATGTGG + Intronic
957208737 3:77233068-77233090 CTTATATGGAAAAGCTAAAGGGG + Intronic
958150882 3:89693044-89693066 CTCCAAAGCCAAAACTAATGTGG + Intergenic
959307428 3:104687376-104687398 TTTATAAGCATAAGGTAATGAGG + Intergenic
960529917 3:118752994-118753016 CTCCTAAGAAAAAGAAAATGAGG + Intergenic
961119002 3:124357243-124357265 ATTCCAAGCAAGAGATAATGAGG - Intronic
962184984 3:133248751-133248773 CTGCTAACCAAAAAATAATGAGG - Intronic
963004769 3:140716777-140716799 CTTCTTGGCCAAAGCTAAAGGGG - Intergenic
963421569 3:145067056-145067078 CTCCTAAGCAAAAGTTACTCAGG + Intergenic
963643691 3:147887512-147887534 ATTCTGGGCAAAAGCTAATCAGG + Intergenic
964894276 3:161576426-161576448 CTTTTAATCAAAAGTTACTGTGG - Intergenic
970420249 4:15899186-15899208 TTTATAAGCATAAGGTAATGAGG + Intergenic
971104425 4:23507217-23507239 CATCCAAACAAAAGCTACTGAGG + Intergenic
971760307 4:30756727-30756749 CATCTAAGCAAGAACTAATGGGG - Intronic
972185539 4:36523384-36523406 CTACAAAGCAAAAGCTTCTGGGG + Intergenic
972791101 4:42372203-42372225 CTTCTACAGAAAAGGTAATGAGG - Intergenic
974645805 4:64690285-64690307 CTTCTAGGCCAAAGCAAATAAGG + Intergenic
975487032 4:74945354-74945376 CTTTTTAGCAACAGATAATGTGG + Intronic
976695468 4:87915511-87915533 CTTTTAATCAGAAGCCAATGAGG - Intergenic
977381829 4:96284317-96284339 CATCTAAGCAATAGCTTCTGGGG - Intergenic
977981005 4:103321757-103321779 TTTCTAAGCCATAGCTTATGGGG + Intergenic
978697384 4:111598210-111598232 CTGCTAAGCAGAAGCTAATTAGG - Intergenic
979220441 4:118217344-118217366 ATTCAACTCAAAAGCTAATGAGG + Intronic
979323835 4:119355755-119355777 CTTCTAAGCAAAAGCTAATGAGG - Intergenic
980014255 4:127630474-127630496 CTTTTAAGGAAAAACTATTGTGG + Intronic
980894014 4:138844231-138844253 CTTCTAAACAAATGCTGATCAGG - Intergenic
982329742 4:154168305-154168327 CTTCTAATAAAAAGATAATTTGG - Intergenic
983241673 4:165240429-165240451 CTTCTAAGCAAAAGCTAATGAGG - Intronic
984263884 4:177473076-177473098 TTTATAAGCATAAGGTAATGAGG - Intergenic
987955772 5:24738019-24738041 ATTCTAAGCAACAACAAATGAGG + Intergenic
989007248 5:36828527-36828549 ATTCTAATCAAAAGCTCATTGGG - Intergenic
989671885 5:43927470-43927492 CTTCTAAGCAGAAGTGAATATGG - Intergenic
989782653 5:45287976-45287998 CCTCTAAGCAAACCCTAGTGAGG + Intronic
990036396 5:51325943-51325965 CTTATAAGCAAAGGGAAATGTGG - Intergenic
990123912 5:52490987-52491009 CATTTCAGCAAAAGCTGATGTGG - Intergenic
991186135 5:63810321-63810343 CTTCTAAGGAAACTATAATGAGG + Intergenic
991358206 5:65791759-65791781 CTTCTGAGCAAAAGAAAAGGGGG + Intronic
996053310 5:118956709-118956731 GTACTAAACAAAAGCAAATGTGG + Intronic
996277225 5:121681548-121681570 CTTTTATGCAAAAGCGAATGAGG - Intergenic
996610614 5:125374687-125374709 CTGCTAAGCAAAAATTAATCTGG + Intergenic
1000981927 5:167825440-167825462 CTTCTAAGCAAACGCTCAGTGGG - Intronic
1001793765 5:174484286-174484308 CTCCTATGCCAAAGCAAATGTGG - Intergenic
1001876581 5:175206806-175206828 AATCCAAGCAAAAGCTACTGAGG + Intergenic
1004201414 6:13551822-13551844 CTTTTTAGCAAAAGGTATTGGGG + Intergenic
1009542610 6:64981786-64981808 CTTCTAACCCAAAGCCAAGGAGG - Intronic
1011618408 6:89219329-89219351 CTTCTAGGCAGGAGCTAATTTGG + Intronic
1012066947 6:94559947-94559969 CTTCCAAGAAAAACCTAACGGGG + Intergenic
1013146208 6:107396117-107396139 CTTCTTAGAAAAAGTTATTGAGG - Intronic
1013532323 6:111031377-111031399 ATTCTAAGTAAGAGCTCATGAGG - Intergenic
1018043378 6:159944769-159944791 CTTCTAAGCAACAGAGAATCAGG + Intergenic
1019092494 6:169551070-169551092 CTTCTAAGGAAAAATAAATGAGG + Intronic
1022634227 7:32116780-32116802 GTTCTAAGCAATAGCAAAAGGGG - Intronic
1022939112 7:35214491-35214513 ATTCAAAGCAAAAGTTAATGGGG + Intronic
1026328117 7:69328603-69328625 CTTCTAAGCAAACACCAAAGTGG + Intergenic
1029070754 7:97894980-97895002 CTACCAAGCCAAATCTAATGAGG + Intergenic
1036815307 8:11898090-11898112 CTTCTCAGCAAAAGATAACTGGG - Intergenic
1036922470 8:12871065-12871087 CTTATAAGCATAGGGTAATGAGG + Intergenic
1037521411 8:19683814-19683836 TTTTTAAGGAAAAGCTATTGAGG + Intronic
1038882573 8:31630817-31630839 GTTCAAAGCATAACCTAATGGGG + Intergenic
1039191553 8:34981925-34981947 ATTCAAAGCAAAAGCCAATATGG - Intergenic
1039212465 8:35233562-35233584 CTTCAAAGCAAAGACTGATGTGG - Intergenic
1041356363 8:57005026-57005048 CTTCTAAGGAAATGGTCATGTGG + Intergenic
1041625933 8:60026991-60027013 TATCTAAGCTTAAGCTAATGAGG - Intergenic
1041853948 8:62427346-62427368 CTGCTGAGCAAAAGCTTCTGAGG + Intronic
1043690869 8:83149971-83149993 CTTCTATATAAAAGCTGATGAGG - Intergenic
1044906768 8:97012717-97012739 CTTCTAAGTAAAAGCTGTTAAGG - Intronic
1044997748 8:97853369-97853391 CATCTGAGTAAAAGCTAATATGG + Intergenic
1047471858 8:125181994-125182016 ATTCAAAGCAAAAGATAGTGAGG - Intronic
1048820606 8:138377070-138377092 TTCCCAAGCAAAATCTAATGAGG - Intronic
1050012239 9:1196659-1196681 ATTTGAAGCAAATGCTAATGGGG - Intergenic
1051764825 9:20512265-20512287 CATCTAAGAAAAATCTACTGTGG - Intronic
1054566484 9:66765991-66766013 TTTATAAGCATAGGCTAATGAGG - Intergenic
1054875525 9:70092394-70092416 CTTCTCAGCCAATGCGAATGTGG + Intronic
1056336008 9:85569750-85569772 GATGTAAGCAACAGCTAATGTGG - Intronic
1056430250 9:86520308-86520330 CTCTTAAGGAAAAGCTAATCAGG + Intergenic
1059871693 9:118585488-118585510 CTTATAATCAAAATCTCATGAGG + Intergenic
1059964921 9:119604165-119604187 CTTTTAAACAAAAGCCAATGTGG + Intergenic
1203693889 Un_GL000214v1:76026-76048 CTTCAAAGTAAAAGCAGATGAGG - Intergenic
1203558342 Un_KI270744v1:24406-24428 CTTCAAAGTAAAAGCAGATGAGG - Intergenic
1203642384 Un_KI270751v1:28037-28059 CTTCAAAGTAAAAGCAGATGAGG + Intergenic
1187057671 X:15756599-15756621 CTTCTAAGCACAAGCCAAAGTGG + Intronic
1188359434 X:29234309-29234331 ATCCAAAGCAAAAGATAATGAGG - Intronic
1189127935 X:38467801-38467823 CTTCCACTCAAGAGCTAATGAGG + Intronic
1189634069 X:42986250-42986272 CTTATAAGTAGAAGCTAAAGGGG + Intergenic
1191169607 X:57429498-57429520 CTTCTTAGTAATAGCTACTGTGG - Intronic
1191645314 X:63473954-63473976 CTTCCAAGAAAAGGGTAATGGGG - Intergenic
1192130393 X:68544161-68544183 CTTCTAAGAAATAGCTTAAGGGG - Intergenic
1192807846 X:74525540-74525562 CTTCTGAGCAACAGCTAAGGAGG - Intronic
1193854408 X:86581052-86581074 CCTATAAGCAGAAGCGAATGGGG + Intronic
1194470736 X:94292394-94292416 CTTCTAATCATAAGCTTATGTGG + Intergenic
1196429379 X:115606437-115606459 CTTCTATGCAAAAGAAAATTAGG - Intronic
1201552950 Y:15237933-15237955 CTTATAAGCCAAAGATTATGTGG - Intergenic