ID: 979323839

View in Genome Browser
Species Human (GRCh38)
Location 4:119355791-119355813
Sequence GTAAGGCATTTGAAAAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979323835_979323839 13 Left 979323835 4:119355755-119355777 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data
979323833_979323839 22 Left 979323833 4:119355746-119355768 CCCAGATGGCCTCATTAGCTTTT 0: 2
1: 0
2: 2
3: 17
4: 175
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data
979323834_979323839 21 Left 979323834 4:119355747-119355769 CCAGATGGCCTCATTAGCTTTTG 0: 2
1: 0
2: 2
3: 13
4: 132
Right 979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979323839 Original CRISPR GTAAGGCATTTGAAAAACCT TGG Intergenic
No off target data available for this crispr