ID: 979325870

View in Genome Browser
Species Human (GRCh38)
Location 4:119378868-119378890
Sequence CCTGAACAGCAGCTAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979325870_979325883 13 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325883 4:119378904-119378926 TCATCTCTGCAGTTGGGGAGGGG No data
979325870_979325876 7 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325876 4:119378898-119378920 GGCCCCTCATCTCTGCAGTTGGG No data
979325870_979325881 11 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325881 4:119378902-119378924 CCTCATCTCTGCAGTTGGGGAGG No data
979325870_979325875 6 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325875 4:119378897-119378919 AGGCCCCTCATCTCTGCAGTTGG No data
979325870_979325882 12 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325882 4:119378903-119378925 CTCATCTCTGCAGTTGGGGAGGG No data
979325870_979325877 8 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325877 4:119378899-119378921 GCCCCTCATCTCTGCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979325870 Original CRISPR CCTGAACAGCAGCTAAAGCA AGG (reversed) Intergenic
No off target data available for this crispr