ID: 979325877

View in Genome Browser
Species Human (GRCh38)
Location 4:119378899-119378921
Sequence GCCCCTCATCTCTGCAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979325868_979325877 30 Left 979325868 4:119378846-119378868 CCTGTTGCTGTTTTCAAGGAGCC 0: 2
1: 0
2: 2
3: 16
4: 160
Right 979325877 4:119378899-119378921 GCCCCTCATCTCTGCAGTTGGGG No data
979325869_979325877 9 Left 979325869 4:119378867-119378889 CCCTTGCTTTAGCTGCTGTTCAG No data
Right 979325877 4:119378899-119378921 GCCCCTCATCTCTGCAGTTGGGG No data
979325870_979325877 8 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325877 4:119378899-119378921 GCCCCTCATCTCTGCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979325877 Original CRISPR GCCCCTCATCTCTGCAGTTG GGG Intergenic
No off target data available for this crispr