ID: 979325881

View in Genome Browser
Species Human (GRCh38)
Location 4:119378902-119378924
Sequence CCTCATCTCTGCAGTTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979325869_979325881 12 Left 979325869 4:119378867-119378889 CCCTTGCTTTAGCTGCTGTTCAG No data
Right 979325881 4:119378902-119378924 CCTCATCTCTGCAGTTGGGGAGG No data
979325870_979325881 11 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325881 4:119378902-119378924 CCTCATCTCTGCAGTTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979325881 Original CRISPR CCTCATCTCTGCAGTTGGGG AGG Intergenic
No off target data available for this crispr