ID: 979325883

View in Genome Browser
Species Human (GRCh38)
Location 4:119378904-119378926
Sequence TCATCTCTGCAGTTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979325869_979325883 14 Left 979325869 4:119378867-119378889 CCCTTGCTTTAGCTGCTGTTCAG No data
Right 979325883 4:119378904-119378926 TCATCTCTGCAGTTGGGGAGGGG No data
979325873_979325883 -10 Left 979325873 4:119378891-119378913 CCCTTCAGGCCCCTCATCTCTGC No data
Right 979325883 4:119378904-119378926 TCATCTCTGCAGTTGGGGAGGGG No data
979325870_979325883 13 Left 979325870 4:119378868-119378890 CCTTGCTTTAGCTGCTGTTCAGG No data
Right 979325883 4:119378904-119378926 TCATCTCTGCAGTTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979325883 Original CRISPR TCATCTCTGCAGTTGGGGAG GGG Intergenic
No off target data available for this crispr