ID: 979330153

View in Genome Browser
Species Human (GRCh38)
Location 4:119414853-119414875
Sequence TCTCAACACCACCACGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979330145_979330153 5 Left 979330145 4:119414825-119414847 CCTCCCCTAGTTCTCCCCTCTGA No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330146_979330153 2 Left 979330146 4:119414828-119414850 CCCCTAGTTCTCCCCTCTGACCA No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330142_979330153 14 Left 979330142 4:119414816-119414838 CCCTGGCCTCCTCCCCTAGTTCT No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330141_979330153 23 Left 979330141 4:119414807-119414829 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330143_979330153 13 Left 979330143 4:119414817-119414839 CCTGGCCTCCTCCCCTAGTTCTC No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330147_979330153 1 Left 979330147 4:119414829-119414851 CCCTAGTTCTCCCCTCTGACCAT No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330137_979330153 29 Left 979330137 4:119414801-119414823 CCCCACCCAGCAACTCCCTGGCC 0: 16
1: 9
2: 27
3: 59
4: 666
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330139_979330153 27 Left 979330139 4:119414803-119414825 CCACCCAGCAACTCCCTGGCCTC 0: 13
1: 10
2: 11
3: 65
4: 829
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330150_979330153 -10 Left 979330150 4:119414840-119414862 CCCTCTGACCATCTCTCAACACC No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330138_979330153 28 Left 979330138 4:119414802-119414824 CCCACCCAGCAACTCCCTGGCCT 0: 13
1: 31
2: 9
3: 48
4: 425
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330140_979330153 24 Left 979330140 4:119414806-119414828 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330149_979330153 -9 Left 979330149 4:119414839-119414861 CCCCTCTGACCATCTCTCAACAC No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330148_979330153 0 Left 979330148 4:119414830-119414852 CCTAGTTCTCCCCTCTGACCATC No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data
979330144_979330153 8 Left 979330144 4:119414822-119414844 CCTCCTCCCCTAGTTCTCCCCTC No data
Right 979330153 4:119414853-119414875 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979330153 Original CRISPR TCTCAACACCACCACGACCC TGG Intergenic
No off target data available for this crispr