ID: 979335004

View in Genome Browser
Species Human (GRCh38)
Location 4:119453614-119453636
Sequence TACTTGAACCCGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979335004_979335014 17 Left 979335004 4:119453614-119453636 CCTCCGCCCCCCGGGTTCAAGTA No data
Right 979335014 4:119453654-119453676 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
979335004_979335012 9 Left 979335004 4:119453614-119453636 CCTCCGCCCCCCGGGTTCAAGTA No data
Right 979335012 4:119453646-119453668 TATCAGCCTCCCAAGTAGCTGGG 0: 51
1: 7892
2: 115176
3: 223951
4: 258294
979335004_979335011 8 Left 979335004 4:119453614-119453636 CCTCCGCCCCCCGGGTTCAAGTA No data
Right 979335011 4:119453645-119453667 TTATCAGCCTCCCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979335004 Original CRISPR TACTTGAACCCGGGGGGCGG AGG (reversed) Intergenic
No off target data available for this crispr