ID: 979337536

View in Genome Browser
Species Human (GRCh38)
Location 4:119480525-119480547
Sequence TCATAGGCTAAGAGGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979337536_979337543 17 Left 979337536 4:119480525-119480547 CCTTTGCCCCTCTTAGCCTATGA No data
Right 979337543 4:119480565-119480587 GTCTTCGTTCCAACTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979337536 Original CRISPR TCATAGGCTAAGAGGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr