ID: 979341205

View in Genome Browser
Species Human (GRCh38)
Location 4:119526320-119526342
Sequence CTTATGATCAGGCTTGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979341205_979341212 20 Left 979341205 4:119526320-119526342 CCTCACACAAGCCTGATCATAAG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 979341212 4:119526363-119526385 AAAAACATTCATTTGGACCAAGG 0: 1
1: 0
2: 0
3: 25
4: 353
979341205_979341213 28 Left 979341205 4:119526320-119526342 CCTCACACAAGCCTGATCATAAG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 979341213 4:119526371-119526393 TCATTTGGACCAAGGAGCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 259
979341205_979341211 13 Left 979341205 4:119526320-119526342 CCTCACACAAGCCTGATCATAAG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 979341211 4:119526356-119526378 CCTATTAAAAAACATTCATTTGG 0: 1
1: 0
2: 7
3: 49
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979341205 Original CRISPR CTTATGATCAGGCTTGTGTG AGG (reversed) Intronic
901357688 1:8665472-8665494 ATTATGATGAGACTTGTGTTGGG + Intronic
901815564 1:11791536-11791558 TCTAGGTTCAGGCTTGTGTGGGG - Intronic
907425128 1:54374720-54374742 CTTGGGGTCAGGGTTGTGTGTGG - Intronic
908557524 1:65271485-65271507 CATATGATCTCACTTGTGTGTGG - Intronic
908806879 1:67940826-67940848 ATTATGTTCATGCTTCTGTGGGG + Intergenic
910034026 1:82768412-82768434 CTTGTGATCATGCTTGTATGAGG - Intergenic
910799643 1:91132200-91132222 CTTCTGATGAGGTTTTTGTGTGG - Intergenic
911114491 1:94232607-94232629 TTTATTTACAGGCTTGTGTGAGG + Intronic
911345717 1:96694350-96694372 CTTTCGATTAGGCTTGTATGTGG + Intergenic
912269294 1:108192901-108192923 CTTCTGATCAGACGTGAGTGAGG - Intronic
913529424 1:119723072-119723094 CACATGATCAGATTTGTGTGTGG - Intronic
915018441 1:152758357-152758379 CTTATGAGCAAAGTTGTGTGTGG + Intronic
915775485 1:158480340-158480362 CTTATGAGCTGGCAGGTGTGTGG + Exonic
915888069 1:159744772-159744794 CTTATGATTAGACTTGGGTAAGG - Intergenic
915998630 1:160591759-160591781 CATATGATCTCGCTTGTATGTGG - Intergenic
918220694 1:182433741-182433763 TCTTTGATCATGCTTGTGTGAGG - Intergenic
919591045 1:199503091-199503113 TTTATGTGCAGGCTTTTGTGTGG - Intergenic
921279371 1:213550531-213550553 CTTATGATAAGCCTTGGGTGTGG - Intergenic
922396900 1:225210976-225210998 CTTCAGATGAGGCTTCTGTGTGG - Intronic
923828036 1:237521839-237521861 CTTATAATGAGGCTGGTGAGAGG - Intronic
1064705518 10:18069209-18069231 CTTATGAAAAGGCTTGTTAGAGG - Intergenic
1066138450 10:32476521-32476543 CTTTTGTTCAGGTTTTTGTGTGG + Intronic
1069837395 10:71318122-71318144 TTTATGATCAGGCCAGTGTTTGG + Intergenic
1070903123 10:80048244-80048266 CTTTTCCTCAGGCTTCTGTGTGG + Intergenic
1073093783 10:100967883-100967905 CTTATGCACAGGCTTGTGTTGGG - Intergenic
1073118410 10:101106557-101106579 CCTATGCTCAGGCTGGTGTGTGG + Intronic
1075402452 10:122170991-122171013 CTTGTGAGGAGGCTGGTGTGTGG + Intronic
1076778830 10:132712835-132712857 CATATGTGTAGGCTTGTGTGGGG + Intronic
1080075757 11:28146701-28146723 CTTATGAACTAGTTTGTGTGAGG - Intronic
1081841426 11:46204249-46204271 GTTATGATGAGGTTTGTGTGGGG + Intergenic
1083581384 11:63827479-63827501 CTTATGACCACTCTTGTGTAAGG - Exonic
1084487128 11:69455060-69455082 CTTATGATCAGACAAGTTTGGGG - Intergenic
1085093930 11:73743266-73743288 CTGTTGATCAGGCTGGAGTGCGG - Intronic
1085199834 11:74695202-74695224 GCTTTGATCAGGCTTGGGTGGGG + Intergenic
1085286559 11:75366179-75366201 CTTATGATTAGGCTGGAGTTAGG - Intergenic
1087173667 11:95076359-95076381 TTTATGTGCAGGCTTTTGTGTGG + Intergenic
1087594936 11:100241683-100241705 CTTTGTATAAGGCTTGTGTGGGG + Intronic
1092561981 12:9625227-9625249 CTAATGCTCTGGCTTGTCTGAGG - Intergenic
1092577251 12:9800050-9800072 TTCATGAGCAGGCTTTTGTGTGG + Intergenic
1093096723 12:14980434-14980456 TTTATGTGCAGGCTTTTGTGTGG + Intronic
1097935606 12:65246642-65246664 CTTTTCATCATGCTTTTGTGTGG - Exonic
1099635039 12:85203010-85203032 TTTAAGATGAGGTTTGTGTGGGG - Intronic
1103748273 12:123141086-123141108 CTCATGTTCATGCTTGTGTTTGG - Intronic
1113030177 13:105984540-105984562 CTTTTGCTCAGGCTTGTTTCAGG - Intergenic
1114370095 14:22077126-22077148 CTTATGAGCAAGCTGGGGTGAGG + Intergenic
1116794005 14:49370146-49370168 CATATGAGCAGGCTTGTTAGAGG - Intergenic
1120565229 14:86047504-86047526 CTTTTGATGAGGTTTCTGTGTGG + Intergenic
1121134097 14:91479402-91479424 CTGTTGCTCAGGCTTGAGTGCGG + Intronic
1127295673 15:57606965-57606987 CTGATGAGCAGGATTGAGTGGGG + Intronic
1129827558 15:78644379-78644401 CTTATAAAAGGGCTTGTGTGGGG + Intronic
1129924733 15:79354032-79354054 CTTTTCTTTAGGCTTGTGTGAGG - Intronic
1135111977 16:19697372-19697394 CTGATGCCCAGGCTTGAGTGCGG + Intronic
1136691103 16:32029933-32029955 TTCATGATAAGGTTTGTGTGGGG + Intergenic
1137881794 16:52056891-52056913 CTACTGAGCAGGCTTGTGTGGGG + Intronic
1203093901 16_KI270728v1_random:1234954-1234976 TTCATGATAAGGTTTGTGTGGGG + Intergenic
1154309694 18:13257525-13257547 CTCATGGGCAGGCGTGTGTGGGG + Intronic
1155465124 18:26126004-26126026 TTTGTGATCATGCTTGGGTGGGG - Intergenic
1156589713 18:38472499-38472521 CTTACAATCAGGCTTATTTGAGG + Intergenic
1158220123 18:55141813-55141835 CTTGTGATCATGCATTTGTGGGG - Intergenic
1159529565 18:69638309-69638331 CTTATAATCAGGCAAGTGTATGG - Intronic
1160602190 18:80022243-80022265 CTAATGATCTGGCTATTGTGGGG + Intronic
1162239075 19:9333700-9333722 CTTATTCTCAGGCTTGTTTCTGG - Intronic
1164808379 19:31136794-31136816 CTGTTGCTCAGGCTTGAGTGTGG - Intergenic
1166427233 19:42689629-42689651 CTGATGGTCAGGGCTGTGTGTGG + Intronic
1166438528 19:42789957-42789979 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166467419 19:43044609-43044631 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166473553 19:43100690-43100712 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166487492 19:43225799-43225821 CTGATGGTCAGACCTGTGTGGGG + Intronic
1167123805 19:47535627-47535649 CTTATGTACAGGTTTTTGTGTGG - Intronic
1168031864 19:53686607-53686629 CTTATCATCAGACTTGGATGAGG + Intergenic
925335805 2:3098432-3098454 CTCAGGATCAGACTTGTCTGGGG - Intergenic
935633054 2:105227714-105227736 CTACTGATCTGGCTTGAGTGAGG - Intergenic
936164325 2:110106743-110106765 CTTGTGTGCAGGCTTTTGTGTGG - Intronic
936694280 2:114928383-114928405 CTGATTTTCAGACTTGTGTGGGG - Intronic
940466662 2:154038100-154038122 CTTATTATCAGGCTGTAGTGAGG - Intronic
940562228 2:155313229-155313251 CTTGTGGACAGGCTTGAGTGGGG - Intergenic
940762164 2:157750226-157750248 CTCATCATCAGGCTTCTGGGTGG - Intronic
943948914 2:194103972-194103994 TTTATGATCAGGCTTTTCTTGGG + Intergenic
944136470 2:196405268-196405290 CTCATGAGCATGCTTGTGTTTGG - Intronic
945043524 2:205762555-205762577 CTTAGGATCATGTTAGTGTGAGG - Intronic
946007424 2:216537485-216537507 CTTATGTGCACGCATGTGTGTGG - Intronic
1169024204 20:2353772-2353794 TTTGTGAGCAGGCTTGTGTGAGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1170319807 20:15082996-15083018 CTTATTATCAGCCTTTTCTGGGG + Intronic
1171418460 20:24999855-24999877 ATTATGATCAGGAATGGGTGGGG + Intergenic
1174553622 20:51378782-51378804 CCTCTGATCGGGCCTGTGTGCGG + Intergenic
1175646714 20:60680330-60680352 CTTATCATCTGGCTTATGAGTGG - Intergenic
1177881203 21:26696948-26696970 CTCATGGTCAGACTTGCGTGGGG - Intergenic
1180185951 21:46139285-46139307 CTTATGCCCAGGCTTGGGGGCGG - Intronic
1181823145 22:25491456-25491478 CTTCTGTACAGGCTTTTGTGTGG - Intergenic
1182077596 22:27505566-27505588 CTTGGGATCAGGGTTGAGTGAGG + Intergenic
949645505 3:6089004-6089026 ATTATGATCAGGCAGGTGTGGGG + Intergenic
951136629 3:19110682-19110704 CATATGCTCAGTCTTTTGTGTGG + Intergenic
951523871 3:23634657-23634679 TTCATGTTCAAGCTTGTGTGTGG + Intergenic
953984375 3:47430165-47430187 CTTCTCATCAGGCTGTTGTGAGG - Intronic
958802485 3:98772342-98772364 CTTATAATTAGGCTTGGGTGTGG + Intronic
959120006 3:102222259-102222281 CTTTTGATGAGGTTTTTGTGTGG + Intronic
960311229 3:116118699-116118721 CTCTTTATCAGGCATGTGTGTGG - Intronic
960555223 3:119020816-119020838 CTTACTGTCAGGATTGTGTGGGG - Intronic
961424056 3:126831058-126831080 CTTTTGCTCAGGCTGGAGTGTGG + Intronic
963517911 3:146331694-146331716 CTGTTGCCCAGGCTTGTGTGCGG - Intergenic
963584545 3:147168631-147168653 CTTTTGCTCAGGCTGGTGAGAGG - Intergenic
964558197 3:157964168-157964190 CTTCTGGACAGTCTTGTGTGTGG - Intergenic
970226622 4:13865100-13865122 CCTATGTGCAGGCTTTTGTGTGG + Intergenic
979341205 4:119526320-119526342 CTTATGATCAGGCTTGTGTGAGG - Intronic
980484792 4:133441801-133441823 CTAATGATCATACTCGTGTGAGG + Intergenic
981766314 4:148254177-148254199 CTTAAGATCTGGCTGTTGTGAGG - Intronic
985280744 4:188283440-188283462 CTTATCATCCAGCCTGTGTGTGG + Intergenic
986257155 5:6109954-6109976 TTTATGATCAAGCTGCTGTGAGG + Intergenic
989754961 5:44940937-44940959 CTTTTGAACAGGTTAGTGTGGGG + Intergenic
990638254 5:57753706-57753728 TTTGTGAACAGGCTTTTGTGTGG - Intergenic
991437150 5:66608682-66608704 CAAATGCTCAGGCTTCTGTGTGG + Intronic
992087905 5:73294567-73294589 CTTCTGAGCAGGCCTGGGTGGGG - Intergenic
992732230 5:79683471-79683493 CTCATGCTCAGGCTGGAGTGCGG - Intronic
992925934 5:81587306-81587328 TTTATGATTAGGGTTGTTTGAGG + Intronic
995245662 5:109932462-109932484 CTTATGTTCACGGTTATGTGTGG + Intergenic
995315727 5:110770494-110770516 CTCATGTGCAGGCTTTTGTGTGG - Intergenic
996195988 5:120607715-120607737 CTTATCATTAGGGTTGTTTGTGG + Intronic
998973417 5:147617530-147617552 ATTATTATCAGGCTTGTTTACGG + Intronic
999386414 5:151157208-151157230 CTTATAAAATGGCTTGTGTGTGG - Intronic
1004407242 6:15344900-15344922 ATTATGATCATTCTTTTGTGTGG + Intronic
1005825660 6:29630408-29630430 CTGATGAGGACGCTTGTGTGAGG - Intronic
1005972059 6:30769267-30769289 CTCATGATCAGGAGTGGGTGGGG + Intergenic
1005996066 6:30932172-30932194 CTTATGCTAAGGCTTGAGTGGGG - Exonic
1008999405 6:57696296-57696318 TTTATGCTCAGCCTTCTGTGTGG + Intergenic
1009776962 6:68217791-68217813 CTTAGGATGAGGTTTTTGTGTGG + Intergenic
1012312653 6:97746917-97746939 CATATGTTCAGGCTTTTATGTGG + Intergenic
1013328660 6:109075046-109075068 CTATTGTTCAGGCTGGTGTGAGG + Intronic
1014180997 6:118384193-118384215 CTTAGCATCAGGCTTTTGTTGGG + Intergenic
1015168589 6:130226380-130226402 CTTATGATCAGCCAAGTTTGAGG + Intronic
1017493329 6:154962945-154962967 CTTTTGCTAAGGCCTGTGTGGGG + Intronic
1019323036 7:424273-424295 CTTAGGATCAGGCATGTGGAGGG + Intergenic
1020267454 7:6570735-6570757 CCAAAGATTAGGCTTGTGTGAGG - Intergenic
1021239453 7:18182346-18182368 ATTAGGAGCAGGCTTCTGTGGGG + Intronic
1024911879 7:54455990-54456012 GTGAAGATCAGGCTTGAGTGTGG + Intergenic
1025121141 7:56304779-56304801 CTGACGATCTGACTTGTGTGTGG + Intergenic
1025262436 7:57427665-57427687 CTTGCAATCAGGCTAGTGTGTGG + Intergenic
1025739789 7:64184906-64184928 CTTGCAATCAGGCTAGTGTGTGG + Intronic
1034160631 7:148991922-148991944 TTTGTGCTCAGACTTGTGTGTGG - Intergenic
1036792179 8:11728403-11728425 CTGATGCTCAGGCTGGAGTGCGG + Intronic
1037379623 8:18270810-18270832 CTTATGCTCAGGCCTGAGGGAGG - Intergenic
1039544045 8:38395184-38395206 CTTATGTACAGGTTTTTGTGTGG + Intronic
1040604351 8:48915369-48915391 ATTATGCTCAGGTTTTTGTGTGG - Intergenic
1045309914 8:100992179-100992201 CTGATGCTCAGGCTGGAGTGCGG + Intergenic
1048665531 8:136657027-136657049 CTTATGGTCAGCCTTGTCAGGGG - Intergenic
1056054448 9:82806421-82806443 CTTATGAATATACTTGTGTGTGG + Intergenic
1056248549 9:84723704-84723726 CATATGGTAAGGCTTGTGTTTGG + Exonic
1058864016 9:109145037-109145059 CCTATTCTGAGGCTTGTGTGGGG - Intronic
1059004097 9:110383228-110383250 CTTTAGATGAGGCTTTTGTGAGG + Intronic
1059178672 9:112191304-112191326 CTGTTGCTCAGGCTGGTGTGCGG - Intergenic
1060187877 9:121574960-121574982 CAGCTGCTCAGGCTTGTGTGTGG - Intronic
1061587367 9:131577705-131577727 CTTATTAACAGTATTGTGTGTGG - Exonic
1202629162 M:2426-2448 CTTATGAGCATGCCTGTGTTGGG - Intergenic
1186147675 X:6641781-6641803 CTAATGATAAGGTTTGGGTGGGG + Intergenic
1186880973 X:13865959-13865981 CTCATGATCCTGCTTGTATGTGG + Intronic
1189688615 X:43592194-43592216 CTTTTGCTCAGGCTGGAGTGAGG + Intergenic
1189875960 X:45436328-45436350 CGTATGTTGAGGGTTGTGTGGGG - Intergenic
1191995901 X:67094851-67094873 CTGGTTCTCAGGCTTGTGTGGGG + Intergenic
1194417896 X:93636311-93636333 CATTTTATCAGTCTTGTGTGAGG - Intergenic
1194820290 X:98497747-98497769 CTGAAGAGCAGGTTTGTGTGTGG - Intergenic
1197464112 X:126782956-126782978 CTCAAGATGAGGTTTGTGTGGGG - Intergenic
1199754464 X:150851482-150851504 CTTAGGGGCAGGCATGTGTGGGG - Intronic
1201223553 Y:11793816-11793838 CATATGGTCAGGCTCTTGTGAGG + Intergenic