ID: 979343428

View in Genome Browser
Species Human (GRCh38)
Location 4:119556343-119556365
Sequence CATTTTAAACAGTAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979343428_979343437 22 Left 979343428 4:119556343-119556365 CCCCCATCCTACTGTTTAAAATG 0: 1
1: 0
2: 1
3: 31
4: 269
Right 979343437 4:119556388-119556410 ATCCTTGACCCTGAAGGAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 231
979343428_979343434 -7 Left 979343428 4:119556343-119556365 CCCCCATCCTACTGTTTAAAATG 0: 1
1: 0
2: 1
3: 31
4: 269
Right 979343434 4:119556359-119556381 TAAAATGTGGATATAATGACTGG 0: 1
1: 0
2: 1
3: 36
4: 372
979343428_979343436 21 Left 979343428 4:119556343-119556365 CCCCCATCCTACTGTTTAAAATG 0: 1
1: 0
2: 1
3: 31
4: 269
Right 979343436 4:119556387-119556409 CATCCTTGACCCTGAAGGAAAGG No data
979343428_979343435 16 Left 979343428 4:119556343-119556365 CCCCCATCCTACTGTTTAAAATG 0: 1
1: 0
2: 1
3: 31
4: 269
Right 979343435 4:119556382-119556404 AGCTGCATCCTTGACCCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979343428 Original CRISPR CATTTTAAACAGTAGGATGG GGG (reversed) Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
902628234 1:17689163-17689185 CATTACATACAGTAGGATGCTGG - Intronic
903790138 1:25887152-25887174 CTTCTTAAAAAGTGGGATGGAGG + Intronic
904646616 1:31972302-31972324 CATTTTAAAAATTAGCATGGTGG + Intergenic
904797923 1:33071408-33071430 CACTTTAACCAGTAGAATGCAGG + Intronic
905839797 1:41165456-41165478 CATTTTGAAAAACAGGATGGAGG - Intronic
906821785 1:48937723-48937745 CATTTTTGACAGTAAAATGGAGG + Intronic
907421578 1:54351274-54351296 CATTTTGAAAAGTAGGAGGAAGG - Intronic
907747284 1:57225779-57225801 CATTTTAGACATTACCATGGAGG + Intronic
907903739 1:58765236-58765258 CATTCTAGGCAGCAGGATGGAGG + Intergenic
909188929 1:72526811-72526833 TATTTTAAAAAGTATGATTGTGG + Intergenic
911407547 1:97461496-97461518 CATTTTAGTCAGTAGGATATTGG - Intronic
911804146 1:102184419-102184441 TAATTTAAACAGGAGGATGTGGG + Intergenic
912977148 1:114341175-114341197 CCTTCCACACAGTAGGATGGAGG - Intergenic
913213861 1:116603735-116603757 CATCTTCAACAGCAGGAAGGAGG - Exonic
918202535 1:182280503-182280525 CATGTGAAATAGTAGCATGGAGG + Intergenic
918891105 1:190269868-190269890 CATTCTAAAAAGTAGGATTGTGG - Intronic
919661288 1:200250453-200250475 CTTTTTAAACATCAGGATCGTGG + Intergenic
920245088 1:204581865-204581887 CATTTTAAACAATATTCTGGTGG - Intergenic
920988579 1:210914152-210914174 CTTTTTAAAAAGTAGGATATGGG - Intronic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
921912885 1:220571486-220571508 CATATTAAATAGTACGATGGTGG - Intronic
923192623 1:231634559-231634581 CAATTTAAACAGTAGATTTGGGG + Intronic
924396527 1:243626974-243626996 AATTTGAAACAGTATCATGGTGG + Intronic
924644811 1:245867756-245867778 CATTTTAAACAGGATGATCGGGG + Intronic
1066084883 10:31966555-31966577 CATTTTAATCACTAGGATATTGG + Intergenic
1066215605 10:33283933-33283955 CACTTTAGATGGTAGGATGGGGG - Intronic
1066305663 10:34137954-34137976 CACTTTAAACAGCATTATGGGGG + Intronic
1068041572 10:51831697-51831719 CATTCTGGCCAGTAGGATGGAGG + Intronic
1068045077 10:51876289-51876311 CATTTTAAATAGTGGAAAGGGGG + Intronic
1068590978 10:58852792-58852814 CATTTTCCACAGCAGGCTGGAGG - Intergenic
1070291702 10:75120567-75120589 CATTTTAAAAAGTATGACGCTGG - Intronic
1071746208 10:88422288-88422310 CATTTTATATGGAAGGATGGGGG + Intronic
1072505899 10:96066676-96066698 CAGTTTAAACATTGGGAAGGAGG + Intergenic
1073507156 10:104006893-104006915 CATTTTAGAAAGTATGATGGGGG - Intronic
1073766850 10:106691983-106692005 AATTTTAAAGAGCAGGTTGGTGG - Intronic
1075001782 10:118804048-118804070 CATTTTAAACAGTTACATAGGGG - Intergenic
1075237561 10:120744771-120744793 CATTTCAGGCAGAAGGATGGAGG + Intergenic
1078968540 11:16376753-16376775 CATTTTTAACAGTTGCCTGGGGG - Intronic
1079126984 11:17724135-17724157 GATTTTAAGCTGTAGGAAGGTGG - Intergenic
1081330076 11:41791333-41791355 CATTTTAAACTGTGTGAGGGAGG - Intergenic
1081473164 11:43395922-43395944 CATTTTTAATAGTAGAATTGTGG + Intronic
1082679194 11:56147802-56147824 CAAATCAGACAGTAGGATGGAGG + Intergenic
1083640362 11:64142074-64142096 CATTTTACAGATTAGGATGGTGG - Intronic
1083723251 11:64614257-64614279 CATTTGAAACAATAGGTGGGAGG - Intronic
1084551283 11:69843636-69843658 CATTTTAAAAATGAGGAGGGGGG + Intergenic
1084573209 11:69972251-69972273 CATTTTCAACAGTAGCCTGTTGG - Intergenic
1085597178 11:77820712-77820734 CATTTTGAACTGGAGGATGGAGG + Exonic
1088296786 11:108306815-108306837 CATTTAAAAAAGTAGGCTGGGGG - Intronic
1088372813 11:109110212-109110234 CATTTTAGAGAGGAGAATGGTGG + Intergenic
1090132475 11:124159151-124159173 CATGTAAAAAAGCAGGATGGCGG - Intergenic
1091948501 12:4571031-4571053 CATCTCAAGCAGTAGGCTGGAGG + Intronic
1093031486 12:14293170-14293192 CATTTGAATCAGTGGGCTGGGGG - Intergenic
1093103104 12:15051832-15051854 CATCTACAACAGTAGGTTGGTGG - Intergenic
1093680119 12:21992929-21992951 CATCTTAAGCAGCAGGAAGGAGG + Intergenic
1094086372 12:26596786-26596808 CATTATAAATATTAGTATGGGGG + Intronic
1095453229 12:42353290-42353312 CATATTATACAGTAGGAAAGGGG - Intronic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096703841 12:53405845-53405867 CATTTTAAAAACTATGATCGGGG + Intronic
1098800795 12:74955321-74955343 CATTATGAAAAGTAGTATGGAGG - Intergenic
1098837386 12:75439143-75439165 CTTTTCAAATAGTAGCATGGTGG + Intergenic
1099048065 12:77748689-77748711 CAACTTAAAGAGTAGGATAGTGG + Intergenic
1100009754 12:89939092-89939114 CATTTTAAACAAGAGAAAGGAGG - Intergenic
1103102882 12:118195396-118195418 GATTTTAAGGAGTAGGATGAAGG + Intronic
1105217091 13:18294286-18294308 CATCTTCAACAGCAGGAAGGAGG - Intergenic
1107791031 13:44002453-44002475 CATTTTAAACAGCAGAATAATGG - Intergenic
1108226598 13:48295816-48295838 CGTTTTAAACAGCAGGGTGCTGG - Intergenic
1109439819 13:62354894-62354916 CATTTTAGAAAATAGTATGGAGG + Intergenic
1109658003 13:65419987-65420009 GATTTTAAACAGCAGAATGATGG - Intergenic
1109720389 13:66268585-66268607 CATATACAACACTAGGATGGTGG - Intergenic
1110507725 13:76307908-76307930 TATTTTAAACACTAGGATGAAGG - Intergenic
1110802440 13:79714527-79714549 CATTATGAAAAGTAGTATGGAGG + Intergenic
1111610982 13:90606283-90606305 CATTTTAAAAAGAATGATAGGGG + Intergenic
1111625507 13:90779526-90779548 AATTTTAAGCAGGGGGATGGTGG - Intergenic
1112246649 13:97741280-97741302 CATTTTACACAGAAAGATGTAGG - Intergenic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113009337 13:105746076-105746098 CATTTTAACCAGTAGTTTTGGGG - Intergenic
1113016934 13:105838283-105838305 CATTTTAAAAAGCGGGAGGGAGG + Intergenic
1113318650 13:109210460-109210482 CATTGTAAACATTTGGATAGTGG - Intergenic
1113360345 13:109625203-109625225 CATTCCAGGCAGTAGGATGGAGG + Intergenic
1116101922 14:40449685-40449707 CATTATAAAAAGTAAGATGAGGG - Intergenic
1116244446 14:42391750-42391772 CATTTCAAAAAATAGTATGGAGG + Intergenic
1116770548 14:49122605-49122627 CATTTTAAAAAATAGGATGCTGG + Intergenic
1116911268 14:50467378-50467400 AATTTTAAATAATAGAATGGTGG - Intronic
1117132434 14:52699363-52699385 CATTTTGAAAAATAGTATGGAGG + Intergenic
1117346031 14:54833670-54833692 GATTATAAACAGCAGTATGGAGG - Intergenic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117866082 14:60150771-60150793 CACTTTTAACAGTAGACTGGAGG + Intronic
1117946948 14:61037242-61037264 CATTTTTGGCAGAAGGATGGTGG + Intronic
1118141019 14:63082722-63082744 CATTATGAACAATAGTATGGAGG + Intronic
1118149176 14:63170527-63170549 CATTTTTAACAGTGTGTTGGTGG - Intergenic
1118689576 14:68325159-68325181 CATTTTAAACATTAAGAAGTTGG - Intronic
1119245325 14:73100190-73100212 GATTTTAAACAGTAGGTCAGTGG + Intronic
1119270558 14:73300472-73300494 GATTTAGAACAGTAGTATGGAGG + Intronic
1120666278 14:87310208-87310230 TATTTTAAACACAAGGATGGTGG - Intergenic
1121809146 14:96864706-96864728 CATTCTTATCAGTAGCATGGAGG + Intronic
1122506820 14:102236862-102236884 TTTTTTAACCAGGAGGATGGTGG - Intronic
1124045285 15:26143671-26143693 AATTTTAAACAGTTGAATGGTGG - Intergenic
1124157718 15:27242126-27242148 CATTTCAAACAGCAGGAATGAGG + Intronic
1124198385 15:27654883-27654905 CATTTTAGAAAATAGCATGGAGG + Intergenic
1125175951 15:36821960-36821982 CATTTTAATCAGGAGCTTGGAGG + Intergenic
1125856307 15:42953185-42953207 CATTTTACATAGTATGCTGGAGG + Intronic
1127291823 15:57578371-57578393 CATGTTAAACAGTAAGATTGTGG + Intergenic
1128694000 15:69746936-69746958 CATAATAAACAGTAGGATTCTGG + Intergenic
1129219639 15:74124234-74124256 CCTTTTAAATAGAAGGATTGGGG - Intronic
1129617318 15:77108978-77109000 AATTTTAAACAGTTGCAGGGAGG + Exonic
1130688176 15:86057290-86057312 GATTTTAAACAGGATGATGATGG - Intergenic
1133603905 16:7367203-7367225 CTTTGCAAACAGTAAGATGGGGG - Intronic
1133845008 16:9445394-9445416 AATTTAAAAAAGTAGGATGTTGG + Intergenic
1135677184 16:24425788-24425810 AATTTAAAAAAGTAGAATGGTGG - Intergenic
1137897787 16:52232957-52232979 ACTTCTAAACAGTAGGATTGAGG - Intergenic
1138224051 16:55277472-55277494 CATTCTAAGAAGTAGAATGGTGG - Intergenic
1138721068 16:59079938-59079960 CATTTTTAACAGTTTGATTGAGG - Intergenic
1140622632 16:76754440-76754462 CATTTTATCCAGTATGATTGGGG + Intergenic
1140871574 16:79111551-79111573 CTTTTGAAAGAGTACGATGGGGG + Intronic
1140944167 16:79752172-79752194 CAAGTTAAACATTATGATGGAGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1151382942 17:73738024-73738046 CATGTTAGGCAGTAGGATGTGGG + Intergenic
1153504522 18:5782134-5782156 GTTTTTACACAGAAGGATGGAGG + Intergenic
1156705503 18:39876668-39876690 CATTTTAAAAGGTAGTATGTTGG - Intergenic
1158574128 18:58621968-58621990 CATTTTAAACAGCAGGGGAGAGG - Intronic
1159533043 18:69679556-69679578 CATTTTAAACAGCATGATTATGG - Intronic
1162671003 19:12257715-12257737 CATTTGAAACCGGATGATGGAGG + Intronic
1165028372 19:32978844-32978866 CATTTTAAAAAGTAAAATAGTGG + Exonic
1168483005 19:56737160-56737182 CATTTTACAAAGGAGGATGGTGG - Intergenic
925501085 2:4505632-4505654 CATTTTAAGCAGAAAGAAGGTGG - Intergenic
925799504 2:7584084-7584106 CATTTTAAAGAGGAGGAAAGAGG + Intergenic
926752780 2:16211545-16211567 CATTCCAAACATCAGGATGGAGG - Intergenic
928583683 2:32735091-32735113 GATTTTAAACGATTGGATGGTGG - Intronic
928604876 2:32936353-32936375 GATTTTACAAAGAAGGATGGTGG - Intergenic
928985527 2:37177505-37177527 CATAATAGAGAGTAGGATGGTGG + Intronic
930044003 2:47152972-47152994 CTTTTGAAAGAGAAGGATGGTGG - Exonic
930428662 2:51245309-51245331 CATTTTGAATAGTAGGATTGTGG - Intergenic
931450189 2:62362128-62362150 CATTTTAAGCTGTAAGTTGGTGG + Intergenic
932076355 2:68667662-68667684 CATTTTAAACAGCAGAATTTTGG - Intergenic
934297233 2:91752396-91752418 CATCTTCAACAGCAGGAAGGAGG + Intergenic
934621091 2:95807544-95807566 CATTAAAAACAGAAGAATGGAGG + Intergenic
934812353 2:97291277-97291299 CATTAAAAACAGAAGAATGGAGG - Intergenic
935225937 2:101053238-101053260 CATTTCAAAAAGAAGGAAGGTGG + Intronic
936742964 2:115537097-115537119 CATTTTAAACTGCAAGATGCAGG + Intronic
940550176 2:155144208-155144230 CTTTTTACACAGAAAGATGGAGG + Intergenic
940990297 2:160089151-160089173 GATTTTAAAATGGAGGATGGAGG + Intergenic
941247583 2:163119490-163119512 AATTGTAAAAAGTAAGATGGAGG + Intergenic
941920032 2:170841063-170841085 GATTTAAAACAGTAGGATGGTGG - Intronic
942567703 2:177282992-177283014 CCTCTTCACCAGTAGGATGGTGG - Intronic
943299013 2:186173965-186173987 CATTTGAGTCAGTAGGCTGGAGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944622409 2:201530173-201530195 CATTTTAGAAAGTAGTATGGAGG + Intronic
947421889 2:229948670-229948692 CATTCTAGACAGTAGGAAGGAGG - Intronic
1170561696 20:17563932-17563954 CATTTTAGGCAGTAAGAAGGAGG - Intronic
1171294458 20:24005402-24005424 CATTTTATTTTGTAGGATGGAGG + Intergenic
1173236261 20:41248530-41248552 CATTTTAAACAGGAATATTGTGG - Intronic
1173970605 20:47149450-47149472 CATTTTAACCAAGAGGATGGGGG - Intronic
1177240392 21:18448035-18448057 CATTATAAACAGTAGTATAAAGG + Intronic
1177464210 21:21453981-21454003 ATTTTTAAACAGTATGATGAAGG + Intronic
1177820166 21:26022666-26022688 CATTATAAAAAGTGGGGTGGTGG + Intronic
1177874367 21:26612829-26612851 CATTTTAACCACAAGGATGGGGG - Intergenic
1178345566 21:31824394-31824416 CCATTTAAACATTAGGATTGTGG - Intergenic
1178504726 21:33153263-33153285 CATTTAAAGCAGGAAGATGGTGG - Intergenic
1179898407 21:44376335-44376357 CATTTTAGCCAGTGGGAGGGCGG + Intronic
1181565137 22:23731956-23731978 AATTTTAAACAGGAGGAATGAGG + Intergenic
1182409419 22:30170516-30170538 CATTTTTAACAGGAGTATGTTGG + Intronic
1182787038 22:32916743-32916765 CATTTTAATAAGTAGGGTAGAGG + Intronic
1182797089 22:32998808-32998830 GTTTTTAAAAAGGAGGATGGAGG - Intronic
1183257615 22:36772800-36772822 CAGTTTAAACAGTAGGGCTGTGG + Intronic
1183802473 22:40178664-40178686 CATTTTAAACATCAGGTTGGGGG + Intronic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949264844 3:2144659-2144681 CATTATTAACATTAGGATGTGGG - Intronic
949717754 3:6952859-6952881 CATTTTAACCACGAGGATGTTGG - Intronic
950223242 3:11212652-11212674 CATTAAAACCAGCAGGATGGTGG - Intronic
951599133 3:24353835-24353857 AATTTTAAACACTAAGATGAGGG + Intronic
956627197 3:71278437-71278459 CGTTTTAAGCACCAGGATGGAGG - Intronic
958622352 3:96577323-96577345 CCTTATATATAGTAGGATGGTGG - Intergenic
958963075 3:100529064-100529086 CATTTTATAAAGTTGTATGGTGG + Intronic
960470135 3:118054194-118054216 CATTTTAAAAAGTAGCAAAGAGG - Intergenic
961062810 3:123845843-123845865 TATTTTAAACAGTGGGGAGGTGG - Intronic
962189829 3:133298819-133298841 AATATTAAACAGTAGAAAGGTGG - Intronic
962537516 3:136343286-136343308 CATTTTAATTACTAGCATGGAGG + Intronic
963677266 3:148328053-148328075 CATTTTAAACATCACGATGAGGG - Intergenic
964892705 3:161556092-161556114 CATTTTAAACAATGGGATTGGGG - Intergenic
965180957 3:165403542-165403564 TATTGTAAACAGTGGGATAGAGG - Intergenic
965433868 3:168622341-168622363 CAGTTTAAATTGTAGGATGATGG + Intergenic
965529579 3:169757636-169757658 TATTTTAAAAATTAGGCTGGCGG + Intergenic
965716816 3:171613624-171613646 AATTTTAAAAAATAGAATGGAGG - Intronic
966583515 3:181595285-181595307 TATTTTAAAAAGTAGTCTGGTGG + Intergenic
967735299 3:192945411-192945433 CATTTTAGACAGTCGTATAGGGG - Intergenic
967787966 3:193517769-193517791 CATTTAAAACAGTCGGTTGTAGG - Intronic
967874784 3:194260529-194260551 CATTCTAGTCAGCAGGATGGAGG - Intergenic
967979207 3:195055412-195055434 CATTGTATAGAGTAGGCTGGAGG - Intergenic
969273411 4:6118366-6118388 CCTTTTAAACAGCAGGATGATGG - Intronic
970664868 4:18325180-18325202 CATTCCAAGCTGTAGGATGGAGG + Intergenic
971457198 4:26856545-26856567 CATTTTGGAAAGTAGTATGGAGG - Intergenic
972138516 4:35924938-35924960 CATTTTAACCCTTAGCATGGAGG - Intergenic
973720382 4:53717920-53717942 TTTTTTAAAAAGTAAGATGGAGG - Intronic
975335275 4:73169304-73169326 CATTTTAAACAGTGAGTGGGAGG + Intronic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977357447 4:95965495-95965517 AATTTAAAACAATAGGATCGGGG - Intergenic
978020973 4:103811179-103811201 CATTTTGAAAAATAGTATGGAGG - Intergenic
978342297 4:107731280-107731302 CATTTGAGTCAGTAGGCTGGGGG - Intergenic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
979409201 4:120354028-120354050 CATTTTAAAAAGTATGATTCAGG - Intergenic
979454940 4:120916570-120916592 CATTTTAAAGAATGGGAAGGAGG + Intronic
980122228 4:128739793-128739815 CAGTTTAAACATTAGTTTGGAGG - Intergenic
980515839 4:133859396-133859418 CATTTTTTACAATAGAATGGAGG - Intergenic
982816759 4:159895433-159895455 CATTTTAATGAGGAGGATTGAGG - Intergenic
983500533 4:168494317-168494339 AATTTTAAAAAGTGGGATGGAGG + Intronic
984737212 4:183120920-183120942 CATTTTAAAAAGTAACATTGTGG + Intronic
987800251 5:22686669-22686691 TCTCTTAATCAGTAGGATGGGGG + Intronic
988640455 5:33035601-33035623 AATCTTAAACATTAGGCTGGGGG - Intergenic
989475871 5:41871775-41871797 CATTTTAAGAAGTTGGATTGGGG + Intergenic
990801040 5:59603567-59603589 CATTATAAAAAATAGTATGGAGG + Intronic
991615731 5:68495398-68495420 TATTTCATACAGTTGGATGGGGG - Intergenic
993060824 5:83036750-83036772 CATTTTAAATAGCAGCACGGTGG + Intergenic
993509030 5:88748299-88748321 CATTTAAAATAGTAGGAGGCAGG - Intronic
994934876 5:106241846-106241868 AATTTCAAACAAGAGGATGGAGG + Intergenic
995409527 5:111839903-111839925 CATTTTACAGAGTAGGAGTGTGG + Intronic
996845035 5:127889700-127889722 CAATTTAAAGAGTAGAATAGAGG - Intergenic
999529297 5:152444687-152444709 CATTTTAAACATTAGAGTGCAGG - Intergenic
999644028 5:153700436-153700458 AAGTATAAACAATAGGATGGTGG + Intronic
1000910563 5:167016788-167016810 CTTTTTAAACAGTTAGATGATGG + Intergenic
1000980728 5:167813851-167813873 CATTGTAATATGTAGGATGGTGG - Intronic
1001580266 5:172793464-172793486 CATCTCAAACAGTGGGATGAGGG - Intergenic
1002496420 5:179615719-179615741 AATTTGAAATAGTAGAATGGTGG - Intronic
1004836196 6:19534557-19534579 CAATTTATACACTAGCATGGGGG + Intergenic
1004994676 6:21178262-21178284 CATTCTAAACTATATGATGGGGG + Intronic
1005430758 6:25754362-25754384 TCTATTAAACAGCAGGATGGTGG + Intergenic
1008581163 6:52908586-52908608 CTTTTTAAACAGCAGATTGGTGG - Intronic
1009042213 6:58191979-58192001 GATATTATAAAGTAGGATGGTGG + Intergenic
1009362710 6:62835192-62835214 CATTATAAACAGTATCACGGGGG - Intergenic
1009806786 6:68609388-68609410 CATTTTAGTCAGTGGGCTGGGGG + Intergenic
1009924385 6:70102320-70102342 CATTCTAAACAGTAGAATAAAGG - Intronic
1010073654 6:71773946-71773968 CATTTTAAAAAGATGGATCGAGG - Intergenic
1011152288 6:84287783-84287805 CATTTTAAGAAGTAGAATGTTGG + Intergenic
1013324448 6:109030926-109030948 CATTTTAAACAGTTGAGTAGTGG - Intronic
1015354881 6:132265998-132266020 CATTTTGAAAAATAGTATGGGGG - Intergenic
1016311515 6:142738501-142738523 CATTTTAAACAGTGGCATACTGG + Intergenic
1016677656 6:146790759-146790781 CATTTGAAACACCAGTATGGAGG - Intronic
1018788281 6:167126041-167126063 CATTTAAAAGAGTAGGGTGGTGG + Intronic
1020419708 7:7987874-7987896 CATTTTAAAAAATAAAATGGTGG - Intronic
1021608801 7:22436078-22436100 CATTTTACACAGTAGGAACAAGG - Intronic
1023934547 7:44730167-44730189 CATTTCAAACAGGGGGATTGGGG - Intergenic
1026219712 7:68383137-68383159 CATTTCAAACAGTAATTTGGAGG - Intergenic
1028109709 7:86925190-86925212 CATTTTAAAGAGTAGCATGATGG - Intronic
1029837404 7:103327392-103327414 GATTTTAATCAGTAGGTTTGGGG + Intronic
1030347424 7:108450306-108450328 AATTTTTAACAGTCTGATGGAGG - Intronic
1030596571 7:111547085-111547107 CATTTTAAGCAGCAGAATGCTGG + Intronic
1031602278 7:123724854-123724876 CATTTAAAACAGTATGAAGGGGG - Intronic
1032748133 7:134808404-134808426 CACTTTAAAAAATAGAATGGGGG - Intronic
1032782884 7:135178248-135178270 CAGTTCAAACAGTAGGATCATGG + Intergenic
1033679651 7:143581631-143581653 GATTTTCAACTGTATGATGGTGG - Intergenic
1033692185 7:143747812-143747834 GATTTTCAACTGTATGATGGTGG + Intergenic
1033718077 7:144023967-144023989 CATTTTAATCTGCAGGGTGGAGG - Intergenic
1034080034 7:148268199-148268221 CAATGAAAACAGTAAGATGGTGG + Intronic
1034747675 7:153537348-153537370 CTTTTTAAACAGTAGGACCTGGG - Intergenic
1035836634 8:2761445-2761467 CATTTTGACCAGTAGGTTGGGGG - Intergenic
1035931219 8:3782492-3782514 CTTTTTAAAAAGGAGGCTGGGGG + Intronic
1036768852 8:11565404-11565426 CCTCTTAAGCGGTAGGATGGGGG + Intergenic
1037156801 8:15710619-15710641 CATTTTAATAAGTAGCCTGGGGG - Intronic
1037426393 8:18760082-18760104 CATTTTGAACATTAAGATAGAGG + Intronic
1037458494 8:19085614-19085636 CATTTCAAATAGGAGGAAGGGGG - Intergenic
1037494610 8:19426495-19426517 CATTTATTACGGTAGGATGGGGG + Intronic
1037839719 8:22235314-22235336 CATTTTAAAAAGGTGGAGGGTGG + Intergenic
1039652314 8:39354876-39354898 CATTTTGGAAAATAGGATGGTGG + Intergenic
1040476767 8:47785210-47785232 CATTTTTAAAAGTAGCATGTTGG + Exonic
1040499733 8:47996046-47996068 TATTTTAACCAAGAGGATGGGGG + Intergenic
1040739447 8:50555185-50555207 CAGTTAAAACAGTAGTATAGGGG - Intronic
1041352104 8:56957511-56957533 ATTTTTAAAAAGTAAGATGGAGG - Intergenic
1041847447 8:62346964-62346986 CATTTTAAACAGGAGAACTGAGG + Intronic
1042081680 8:65060636-65060658 CTTTTTAAACAGCTGCATGGTGG - Intergenic
1042186780 8:66143938-66143960 CATTTAAAACAGTGGTATGATGG + Intronic
1042680966 8:71383386-71383408 CATTTGAAACAGTATTGTGGTGG - Intergenic
1044459986 8:92432911-92432933 CATTTTAAACAGAAAAGTGGAGG - Intergenic
1045103013 8:98864267-98864289 TGTTTTAGACAGTAGGAAGGAGG - Intronic
1045130538 8:99147060-99147082 AATTTTAATCAGGAGGAAGGGGG + Intronic
1045652336 8:104352767-104352789 CACGTGAAACAGTAGGGTGGTGG + Intronic
1046117932 8:109806795-109806817 CAGTTTGAACATAAGGATGGGGG + Intergenic
1047592445 8:126341568-126341590 TATTGAAAACAGTGGGATGGAGG + Intergenic
1048104454 8:131392552-131392574 CATTTTAAACAATAAGTTGATGG + Intergenic
1048108236 8:131436537-131436559 CATTATAGAAAGTAGTATGGAGG + Intergenic
1048500874 8:134974088-134974110 CCTTTTAAAGAGTAGGAAGTAGG - Intergenic
1050576155 9:6997705-6997727 CATTTTACACAGGAGGAAAGAGG - Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1052693762 9:31849926-31849948 CATTTAAAACAGTCTGATGATGG - Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055065862 9:72117672-72117694 CATTTTAACCAGTGAGATGAGGG - Intronic
1055613190 9:78044091-78044113 AACTGTAAAGAGTAGGATGGAGG + Intergenic
1058874205 9:109228813-109228835 TATTTTAAAGAGTAGGAAGGTGG - Intronic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1186497592 X:10024085-10024107 CATTGTAACCAGGTGGATGGAGG - Intronic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1187907130 X:24077364-24077386 CATTTCAAACTGTATGATGTGGG - Exonic
1188165229 X:26854396-26854418 CATTGTAAAAAGTAGAATGTTGG - Intergenic
1188344611 X:29048266-29048288 CATATTTATTAGTAGGATGGTGG - Intronic
1189410112 X:40762566-40762588 CATTTTAAAAAGTAAAATGTTGG + Intergenic
1194560704 X:95416178-95416200 CATTTTAAACATTAATATTGAGG + Intergenic
1197862667 X:130987063-130987085 CATTCCAAGCAGTAAGATGGGGG + Intergenic
1198879151 X:141260668-141260690 TTTTTTAAACAGTAGGATTTGGG + Intergenic
1199663218 X:150073648-150073670 GATTTTACACAGTTGGGTGGTGG - Intergenic
1201865827 Y:18653230-18653252 CACTTTAAATAGTAGGTTGGAGG + Intergenic