ID: 979346845

View in Genome Browser
Species Human (GRCh38)
Location 4:119597787-119597809
Sequence TCATTTCTGACCCCAATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979346845_979346848 -1 Left 979346845 4:119597787-119597809 CCATCAATTGGGGTCAGAAATGA 0: 1
1: 0
2: 0
3: 5
4: 149
Right 979346848 4:119597809-119597831 AGGCCAATTTTCAACTGAGAGGG No data
979346845_979346847 -2 Left 979346845 4:119597787-119597809 CCATCAATTGGGGTCAGAAATGA 0: 1
1: 0
2: 0
3: 5
4: 149
Right 979346847 4:119597808-119597830 GAGGCCAATTTTCAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979346845 Original CRISPR TCATTTCTGACCCCAATTGA TGG (reversed) Intronic
902835245 1:19043167-19043189 TCCTTTCTTGCCCCATTTGAGGG - Intergenic
902942264 1:19809043-19809065 TCCTGTCTGACCCCACTTGTAGG + Intergenic
903024631 1:20418575-20418597 TAACTTCTGACCCCAAGTCAGGG + Intergenic
904445076 1:30565485-30565507 CCATTTCTAACCCAAAATGAGGG - Intergenic
907675169 1:56511268-56511290 TCATCTCTGACTCCAGGTGAAGG - Intronic
910857098 1:91706757-91706779 CCAATTCAGACCCCAATAGAGGG - Intronic
914744098 1:150488380-150488402 TCATTTCTTTCCCCAATGAAAGG - Intronic
916847897 1:168671866-168671888 TCATTTCAGAGCTCAACTGAGGG + Intergenic
917055608 1:170978299-170978321 TCATTTCTTCCCCAAATTGAGGG + Intronic
919032170 1:192256262-192256284 TAATTTTTGACACCAATTTAAGG + Intergenic
924280350 1:242430734-242430756 TGATGTCTGCTCCCAATTGAGGG - Intronic
1063251169 10:4276561-4276583 ACATTTCTGAGCCCAAATGCAGG - Intergenic
1066300518 10:34091752-34091774 TTATTACTGTCCCCACTTGATGG + Intergenic
1066608456 10:37208581-37208603 TCATTTCTGCAGCAAATTGAGGG + Intronic
1067770421 10:49118807-49118829 TCATTGGTGACCCCAATAGAGGG + Intergenic
1071074465 10:81734176-81734198 GCATTTCTGACCCTAATTCCTGG + Intergenic
1072426979 10:95337983-95338005 TCATCACTGACCCCAGTAGAGGG - Intronic
1078458895 11:11498071-11498093 TCATATGTGAAACCAATTGAGGG + Intronic
1079439470 11:20495895-20495917 TATTTTCTTCCCCCAATTGATGG - Intronic
1079830067 11:25253685-25253707 TCATTTCTGTTTCCAATTCAAGG - Intergenic
1081410777 11:42755782-42755804 TACTTTCTGACTGCAATTGATGG + Intergenic
1081846835 11:46246845-46246867 TTATTTCTGCCTCTAATTGAAGG - Intergenic
1081852929 11:46286070-46286092 TCATTTCTGAACTAAACTGAGGG + Intronic
1086155562 11:83661823-83661845 TCATATCTGCCCCCAATAGGAGG - Intronic
1091876776 12:3941285-3941307 ACATTTCTGACCAGAATTGGTGG - Intergenic
1093860446 12:24159558-24159580 TCATTTCTATGCCTAATTGATGG - Intergenic
1095704390 12:45221650-45221672 GCATTTCTGACCCCAACTACTGG - Intronic
1098101243 12:67019117-67019139 TCATTTCTGTCTCCAACTCAAGG - Intergenic
1100197214 12:92260487-92260509 ACATGTCTGACCCCAGGTGAAGG - Intergenic
1103280317 12:119752864-119752886 TCATTTTTCTCCCCACTTGAAGG - Intronic
1106558703 13:30831299-30831321 CCAATTCTGAACCCAAATGATGG - Intergenic
1107708624 13:43131369-43131391 TCAATTCAGACCCCAAGAGAGGG + Intergenic
1108176721 13:47799762-47799784 TCACTTCTGACACCAAATCAGGG - Intergenic
1109255563 13:60076274-60076296 TTATTTCTGACCCCTTGTGAGGG - Intronic
1109579282 13:64304526-64304548 GCAACTCTGACCCCAAATGAAGG - Intergenic
1110321712 13:74167591-74167613 TCATTTCAGTACCAAATTGACGG - Intergenic
1112483653 13:99800413-99800435 TCATTTCTGGCTCCATTTGTTGG - Intronic
1112622487 13:101066401-101066423 TCAGTTCTGACCCCAGAAGAGGG - Intronic
1114739335 14:25079127-25079149 GCCATTCTGACCCCAAGTGAAGG - Intergenic
1116372809 14:44157573-44157595 TCTTTTCTAACCACAATTGTTGG + Intergenic
1118715936 14:68560170-68560192 TCGTTTCTCAGCCCATTTGATGG - Intronic
1122030946 14:98911398-98911420 TCATTTCTGACCCCAGGCCAGGG - Intergenic
1122280140 14:100617215-100617237 TCACTTCTGACACCAGCTGAGGG - Intergenic
1122646449 14:103197623-103197645 ACATTTCTGACACTAAATGAGGG + Intergenic
1124336520 15:28861378-28861400 TCTTTACTGACCCCACGTGATGG + Intergenic
1131216377 15:90539347-90539369 TCCTTCCTTACCCCAATTAATGG + Intronic
1132344933 15:101102408-101102430 TCAGGTCTGACCCCTAGTGAAGG - Intergenic
1134055579 16:11167781-11167803 CTATTTCTGAGCCCAATTTAAGG + Intronic
1134167545 16:11942557-11942579 TAAATTCTGAACCCAAATGAGGG + Intronic
1134352776 16:13453301-13453323 GCATTCATGACCCCAATTAATGG + Intergenic
1134419937 16:14077354-14077376 TCATCTCTGAATCCAGTTGATGG + Intronic
1134493153 16:14711155-14711177 TAAATTCTGAACCCAAATGAGGG - Intronic
1134498534 16:14750279-14750301 TAAATTCTGAACCCAAATGAGGG - Intronic
1134525088 16:14936909-14936931 TAAATTCTGAACCCAAATGAGGG - Intronic
1134547806 16:15124010-15124032 TAAATTCTGAACCCAAATGAGGG + Intronic
1134582040 16:15378806-15378828 TAAATTCTGAACCCAAATGAGGG + Intronic
1134712676 16:16335396-16335418 TAAATTCTGAACCCAAATGAGGG - Intergenic
1134720541 16:16378711-16378733 TAAATTCTGAACCCAAATGAGGG - Intergenic
1134946886 16:18333174-18333196 TAAATTCTGAACCCAAATGAGGG + Intronic
1134954151 16:18373297-18373319 TAAATTCTGAACCCAAATGAGGG + Intergenic
1135037932 16:19093869-19093891 TCATTTCTGACCCTGCATGAAGG - Intergenic
1135312975 16:21420209-21420231 TAAATTCTGAACCCAAATGAGGG + Intronic
1135365899 16:21852489-21852511 TAAATTCTGAACCCAAATGAGGG + Intronic
1135445916 16:22518673-22518695 TAAATTCTGAACCCAAATGAGGG - Intronic
1136152131 16:28357941-28357963 TAAATTCTGAACCCAAATGAGGG + Intronic
1136168385 16:28471809-28471831 TAAATTCTGAACCCAAATGAGGG + Intergenic
1136194617 16:28643242-28643264 TAAATTCTGAACCCAAATGAGGG - Intronic
1136210949 16:28757341-28757363 TAAATTCTGAACCCAAATGAGGG - Intronic
1136255671 16:29037300-29037322 TAAATTCTGAACCCAAATGAGGG - Intergenic
1136309643 16:29398937-29398959 TAAATTCTGAACCCAAATGAGGG + Intronic
1136323088 16:29500717-29500739 TAAATTCTGAACCCAAATGAGGG + Intronic
1136437772 16:30240685-30240707 TAAATTCTGAACCCAAATGAGGG + Intronic
1137435422 16:48450939-48450961 TGACTTCTGACCCCAACTCAGGG + Intergenic
1139857326 16:69991316-69991338 TAAATTCTGAACCCAAATGAGGG + Intergenic
1140208306 16:72951049-72951071 TCCTTTTGGACCCCAGTTGAGGG - Intronic
1140365348 16:74376604-74376626 TAAATTCTGAACCCAAATGAGGG - Intergenic
1149047407 17:52263703-52263725 TCATTTCTGCCAACAATTAATGG - Intergenic
1150840736 17:68603274-68603296 TTTTTTCTGGCCCCAATTTAGGG + Intergenic
1151131537 17:71902434-71902456 TCATTACTGGCCCCATTTTATGG + Intergenic
1151377242 17:73698285-73698307 TCATTTCTGTCCCCATTCGTGGG + Intergenic
1153589859 18:6661940-6661962 TCATTTCCTTCCACAATTGATGG - Intergenic
1154118772 18:11634564-11634586 TAAATTCTGAACCCAAATGAGGG + Intergenic
1158614969 18:58978882-58978904 TCATATCTGACCTCATGTGACGG - Intronic
1161581463 19:5083158-5083180 TCAGTTCAGACGCCAATTGCTGG - Intronic
1167727535 19:51226264-51226286 TCATCTCTACCCCCAACTGAAGG + Intronic
1168139203 19:54373949-54373971 TCATTTCTGTCCAGAATTGTTGG + Intergenic
925736653 2:6969684-6969706 TCATATTTGACCTCAAGTGACGG + Intronic
927820918 2:26264017-26264039 TCTTTTCTGTCCCCGAGTGAAGG + Intronic
928630393 2:33185687-33185709 ACATTTCTAAACCCAATGGATGG - Intronic
929057067 2:37887465-37887487 TCGTTTCTGACCACAGTGGAGGG + Intergenic
929730067 2:44479563-44479585 ACATTTCTGTCCCCAGTAGAGGG + Intronic
930569355 2:53065410-53065432 TCATTTCTGAGCCACATTAACGG + Intergenic
930672036 2:54161393-54161415 TCTTATCTAACCCCTATTGATGG + Intronic
932009621 2:67962013-67962035 TCACTTCTGACACCAATTTTGGG - Intergenic
941420964 2:165282305-165282327 ACTTCTCTGACCCCAATTGAGGG + Intronic
941496616 2:166212784-166212806 TCTTTTATGACCACAATGGAAGG + Intronic
941735303 2:168968240-168968262 ACATTTCTCTCCCCAATTCATGG - Intronic
942657891 2:178233244-178233266 TCATTTCTGAAGCAAATTCAAGG - Intronic
945298389 2:208193364-208193386 TCCTTTCTGACAACAAATGAAGG + Intergenic
946981899 2:225227279-225227301 GCATTTCTGATCTCAAGTGAAGG - Intergenic
946987476 2:225288780-225288802 CCATTCATGACCCCAAATGAAGG - Intergenic
1171104132 20:22416327-22416349 ACATTTTTGACCACAATTCAGGG + Intergenic
1171131458 20:22657477-22657499 TCATTTCTCATCCCAGTGGATGG - Intergenic
1171871613 20:30531418-30531440 ACATTTCTGACCAGACTTGATGG + Intergenic
1174927857 20:54780506-54780528 TCATTTCAGCGCCCAATTGAAGG - Intergenic
1175582738 20:60113082-60113104 TCATTTCCAGCCCCAATAGATGG - Intergenic
1176979180 21:15359772-15359794 TCATCTCTGAGCCCAGTTCATGG + Intergenic
1177594849 21:23225234-23225256 TTAATTCTGACCCCAAATAAGGG + Intergenic
1177952622 21:27557673-27557695 TCATTTCTGACCCCTCTTTTTGG - Intergenic
1184073159 22:42159230-42159252 TCATTACTGAAGCCAATTTAAGG + Intergenic
951295892 3:20934234-20934256 TCTTTTCTGACCCCAATCTCAGG - Intergenic
951387197 3:22057015-22057037 TCACTTCTGACACAAATTCATGG - Intronic
952044315 3:29299556-29299578 TAATTTCTACCCCCACTTGATGG - Intronic
956068264 3:65419748-65419770 TATTTGCTGACCCCAACTGAAGG - Intronic
956920762 3:73926804-73926826 TTTTTTCTGATCCCAATTAATGG + Intergenic
962172378 3:133115436-133115458 TCATTATTTACCCCATTTGAGGG + Intronic
962941768 3:140131051-140131073 TCATTTCTGAAGGCCATTGAAGG - Intronic
971111757 4:23592800-23592822 TCCTTTCTGCCACCAAGTGAAGG + Intergenic
972350664 4:38233436-38233458 TCATTTCTGCCCACATTTTATGG + Intergenic
974609775 4:64200997-64201019 TCAATTCAGACCCCAAGAGAGGG - Intergenic
975512067 4:75205183-75205205 TGATCTCTGACCCCAATCCAGGG - Intergenic
979346845 4:119597787-119597809 TCATTTCTGACCCCAATTGATGG - Intronic
979725313 4:123954153-123954175 CCATTTCAGACCCCAAGAGAGGG + Intergenic
980313889 4:131170966-131170988 TCATATCTGACTTAAATTGAGGG - Intergenic
985957432 5:3276069-3276091 GCAAGTCTGACCCCAAATGAAGG + Intergenic
987118675 5:14746368-14746390 TCATCTCTGACCCCAATGCTCGG - Intronic
990560029 5:56974579-56974601 TGAAGTCTGACCCCAAGTGAAGG - Intergenic
990676469 5:58191847-58191869 TTATTTCCAACCCCAATTGCTGG - Intergenic
994786466 5:104171111-104171133 TCATTTCTGAGGCCAATGCAAGG - Intergenic
997784211 5:136692968-136692990 ACATTTGTGACACCAATTCAAGG + Intergenic
998878800 5:146626787-146626809 TCATTCAAGACCCCAAGTGAGGG + Intronic
1008979732 6:57469166-57469188 TCACTTCTCATCCCAAGTGAAGG + Intronic
1015005522 6:128276494-128276516 TTATTTCTGGCTCTAATTGATGG - Intronic
1016992031 6:149936935-149936957 GCAATTCTGACCCCAAGTGCAGG + Intergenic
1016994593 6:149952877-149952899 GCACTTCTGACCCCAAGTGCAGG + Intergenic
1017467789 6:154710849-154710871 TATTTTCTGACTCCAGTTGATGG + Intergenic
1023233990 7:38064910-38064932 TTATTTCTGACCCAAATTAAAGG - Intergenic
1033531799 7:142271685-142271707 TAATTTTTTACCCCAATTTATGG - Intergenic
1033680428 7:143588982-143589004 TGATTTTTTAACCCAATTGAGGG + Intergenic
1033704466 7:143872830-143872852 TGATTTTTTAACCCAATTGAGGG - Intronic
1041239200 8:55834594-55834616 TATGTTCTGACCTCAATTGACGG - Intergenic
1041929525 8:63271747-63271769 TCAATGCTGAATCCAATTGAAGG - Intergenic
1044067358 8:87715320-87715342 TGATTTCTGTCCCCAACTCAGGG + Intergenic
1047588842 8:126304365-126304387 TCAGATCTGACACCAATAGAAGG + Intergenic
1048376553 8:133827642-133827664 TCTTTGCTGAACCCAATGGAGGG - Intergenic
1050116430 9:2268237-2268259 ACAAGTCTGACCCCAAGTGAAGG - Intergenic
1052766386 9:32645341-32645363 TCTTTTCTGACCTCCATTCATGG + Intergenic
1053340911 9:37329954-37329976 ATATTTCTTACCCCAAATGATGG + Intronic
1055282028 9:74685370-74685392 TCCTTTCTGGCCCCAGATGAAGG - Intronic
1056059658 9:82870906-82870928 TCATTTATCCCCCCAAATGAAGG + Intergenic
1059592479 9:115677144-115677166 TCTTTTCTATCCCCATTTGAGGG + Intergenic
1060665670 9:125430829-125430851 TTATTTCTGTCCCCATTTCACGG + Intergenic
1196412582 X:115435500-115435522 TCAATTCAGACCCCAAGGGAGGG - Intergenic
1197493369 X:127147350-127147372 TCAATTCTGACACTATTTGAAGG + Intergenic
1200900994 Y:8431789-8431811 TCATTTCTGGACCCAGATGAAGG - Intergenic