ID: 979346847

View in Genome Browser
Species Human (GRCh38)
Location 4:119597808-119597830
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979346845_979346847 -2 Left 979346845 4:119597787-119597809 CCATCAATTGGGGTCAGAAATGA 0: 1
1: 0
2: 0
3: 5
4: 149
Right 979346847 4:119597808-119597830 GAGGCCAATTTTCAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr