ID: 979346915

View in Genome Browser
Species Human (GRCh38)
Location 4:119598836-119598858
Sequence CTGGGGGGTTGGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1297
Summary {0: 1, 1: 0, 2: 6, 3: 116, 4: 1174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979346904_979346915 22 Left 979346904 4:119598791-119598813 CCAAACTTCTGAAGTGGTTGGAA 0: 1
1: 0
2: 0
3: 9
4: 171
Right 979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG 0: 1
1: 0
2: 6
3: 116
4: 1174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979346915 Original CRISPR CTGGGGGGTTGGAAGGAAGA TGG Intronic
900081175 1:858720-858742 CCGGTGGGAAGGAAGGAAGAGGG + Intergenic
900313865 1:2047715-2047737 CTCTGGGGTTGGGAGGGAGAGGG - Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900666716 1:3820503-3820525 CTGGGGTGGAGGAAGGCAGATGG + Intronic
900707378 1:4089160-4089182 CAGGGTGGTTGGAAGGAGCATGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900819150 1:4872912-4872934 TTGGGGGGTGGGGAGGAAGAGGG - Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
902167771 1:14586026-14586048 TGGGGGTGTTGGAAGGGAGAGGG + Intergenic
902248919 1:15140540-15140562 CTGGAGTGTGGGAAGCAAGAAGG + Intergenic
902402377 1:16165348-16165370 GTGGAGGCTTGGAAGGAAGAAGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
903375708 1:22864576-22864598 CTGGGCTGTTCTAAGGAAGAAGG + Intronic
903514175 1:23899351-23899373 CTTGGAGGTTAGAAGCAAGATGG - Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904282980 1:29434306-29434328 ATGGGGGGGTGGAAGGAAAGAGG - Intergenic
904303395 1:29570843-29570865 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904733570 1:32613124-32613146 CTTGGAGGTTAGAAGCAAGATGG - Intronic
904790770 1:33018993-33019015 CTGGGGGGCAGGAAGGTAGAAGG - Intronic
904810471 1:33160305-33160327 CTTGGGGGTAGGAGGGATGAGGG + Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905262224 1:36727947-36727969 CTGGGGGCTGTGAATGAAGATGG + Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905530080 1:38671044-38671066 GAGGGTGGTGGGAAGGAAGAAGG - Intergenic
905564515 1:38953148-38953170 CTTGGAGGTTAGAAGTAAGATGG - Intergenic
905587552 1:39132757-39132779 GTGGGGGGTGGGAAGGAAGGAGG + Intronic
905658074 1:39698965-39698987 ATGGGAGTTTGGAAAGAAGAAGG - Intronic
905910013 1:41647280-41647302 ATGGGGTTTTGGAAGGAAGGTGG + Intronic
906009338 1:42509167-42509189 CTTTGGGGCTGGAAGCAAGATGG - Intronic
906019834 1:42617997-42618019 CTTGGAGGTTAGAAGTAAGATGG + Intronic
906294837 1:44643224-44643246 CTGGTGGGGTAGAAGGGAGAAGG + Intronic
906454452 1:45981686-45981708 CTTGGAGGTTAGAAGCAAGATGG + Intronic
906720302 1:47999086-47999108 CTGGGTGGTTGGGAGGAACACGG + Intergenic
907391539 1:54161427-54161449 CAGGGGAGTCGGATGGAAGAGGG + Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907525121 1:55049573-55049595 CCGGGGGTTTGGAAGATAGAGGG + Intronic
907615505 1:55920726-55920748 AGGGGGGGTGGGAAGGAAGGAGG + Intergenic
907838889 1:58137508-58137530 GGGGGTGGTTGGATGGAAGATGG - Intronic
908068892 1:60436770-60436792 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908316842 1:62941038-62941060 CAGGAGGGTTGGAAGGGTGATGG - Intergenic
908325090 1:63015941-63015963 CTTGGGGCTTGCAAGGAACAAGG + Intergenic
908485289 1:64585978-64586000 CTGAGGGGTTGGAACAAAGGTGG - Intronic
908702321 1:66915362-66915384 CTTGGAGGTTAGAAGCAAGATGG + Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909263564 1:73527032-73527054 TGGGGGAGTTGGAAGGGAGATGG - Intergenic
909277761 1:73709750-73709772 CTTGGGGGAAGGAAGCAAGAAGG + Intergenic
909687587 1:78368201-78368223 CTTGGAGGTTAGAAGCAAGATGG - Intronic
909828916 1:80160683-80160705 CTTGGGGATTAGAAGCAAGATGG + Intergenic
910229067 1:84967823-84967845 GTGGAGGGAGGGAAGGAAGAAGG + Intronic
910363744 1:86441574-86441596 GTGGGGAGTGGGAAGGGAGAAGG + Intronic
910795124 1:91090373-91090395 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
910796595 1:91103443-91103465 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
911242277 1:95479523-95479545 CTGGGGGCTTGGAAGGCATTGGG - Intergenic
911539051 1:99136715-99136737 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
911658105 1:100467605-100467627 CTGGGGGGTTGGGATGAGGGTGG - Intronic
911747084 1:101451986-101452008 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
911798456 1:102103862-102103884 CTTGGAGGTTAGAAGCAAGAAGG + Intergenic
911841510 1:102688057-102688079 CTGTGAGGTGGGAAGCAAGATGG - Intergenic
912020769 1:105106933-105106955 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
912524077 1:110267759-110267781 CTGTGAGGTTAGAAGCAAGATGG - Intronic
912582015 1:110729472-110729494 CTAGGAGGTTAGAAGCAAGATGG + Intergenic
912629854 1:111237327-111237349 CTTGGAGGTTAGAAGCAAGATGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912826075 1:112904530-112904552 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913126852 1:115799068-115799090 CTCGGAGGTTAGAAGCAAGATGG - Intergenic
915267641 1:154730483-154730505 TTGGGAGGTTGGGAGGAGGAGGG + Intronic
915303370 1:154963933-154963955 TGGGAGGGTGGGAAGGAAGAAGG + Intronic
915724531 1:158008156-158008178 GAGGGGGGTGGGGAGGAAGAGGG + Intronic
916124305 1:161555703-161555725 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
916134187 1:161637062-161637084 CTTGGAGGTTAGAAGCAAGATGG + Intronic
916242935 1:162657883-162657905 TGGGGGCGTTGGAAGGGAGAGGG - Intronic
916245514 1:162684267-162684289 ATAGAGGCTTGGAAGGAAGAAGG - Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916561140 1:165934918-165934940 CTGGGGTGCTGGAAGAAAGGAGG + Intergenic
916812420 1:168317147-168317169 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
916974648 1:170062982-170063004 ATGTGAGGTTGGAAGCAAGATGG - Intronic
917232169 1:172849847-172849869 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
917557240 1:176102508-176102530 CTTGGAGGTTAGAAGCAAGATGG - Intronic
917557505 1:176105932-176105954 CTTGGAGGTTAGAAGTAAGATGG - Intronic
917617744 1:176763801-176763823 CTGGGAAGTTCAAAGGAAGAGGG + Intronic
917793267 1:178513402-178513424 CTTGGGGGTGGGAAGGAAAGAGG + Intronic
917805669 1:178611308-178611330 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
918307231 1:183258426-183258448 CTTGGAGGTTAGAAGCAAGATGG - Intronic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
919653509 1:200174696-200174718 CTGGGGCCTTCAAAGGAAGAGGG - Exonic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919927718 1:202200914-202200936 CTGGCGGGTTGGAGGGGAGCTGG + Intronic
919986073 1:202676168-202676190 GTGGGGGGAAGGGAGGAAGATGG - Intronic
920455713 1:206099640-206099662 CTTGTGGGCTGGAAGGGAGAGGG - Exonic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921035854 1:211377339-211377361 CTTGGGGGTTAGAAGTGAGATGG + Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
921679858 1:218018314-218018336 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
921883037 1:220275632-220275654 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922775661 1:228213262-228213284 CTGGGAGGCTGGAAAGGAGAGGG - Intronic
922815684 1:228447139-228447161 CTGGAGGGTTGGAAGAAGGGTGG + Intergenic
922878067 1:228956694-228956716 CTTGGAGGTTAGAAGCAAGACGG - Intergenic
922912347 1:229228366-229228388 CGGGGGGGTGGGAAGGGGGAGGG - Intergenic
922916618 1:229263278-229263300 CTGGGGGGATGAAATGGAGAGGG + Intergenic
922963156 1:229665249-229665271 TTTGGAGGTTTGAAGGAAGATGG - Intergenic
923328682 1:232902570-232902592 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
923336709 1:232977238-232977260 CTGGGGGGCAGGCAGGAACAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923483657 1:234408305-234408327 CTTGGAGGTTAGAAGCAAGATGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923709100 1:236370960-236370982 CTTGGAGGTTAGAAGCAAGATGG + Intronic
923779383 1:237008706-237008728 CTTGGAGGTTAGAAGAAAGACGG - Intergenic
924807779 1:247374910-247374932 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
924809471 1:247388541-247388563 CTTGGAGGTTAGAAGCAAGAAGG + Intergenic
924858708 1:247899515-247899537 ATGGGCGGTAGGAAGAAAGATGG + Intergenic
924938400 1:248791722-248791744 CTGGGAGGTTGCAAGGATGATGG - Intergenic
1063302821 10:4867168-4867190 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1063441061 10:6073613-6073635 CTTGAGGGTGGGAAGGGAGATGG - Intergenic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1063510735 10:6642843-6642865 CTGGAGGGCTGGGAGGGAGAGGG + Intergenic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064328884 10:14375563-14375585 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1065061295 10:21903813-21903835 GTGGGGGGTTGGAAATCAGATGG + Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1066101934 10:32125222-32125244 CTGAGGGGTTGTGAGGAAGGGGG - Intergenic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1066207720 10:33206020-33206042 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1067141445 10:43660463-43660485 CTGGTGAGTTGGAAGGAACAAGG - Intergenic
1067469313 10:46524546-46524568 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1067807957 10:49406098-49406120 TTGGGGGGTAGGAATGCAGAAGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1067823488 10:49551140-49551162 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1068111741 10:52688625-52688647 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1068496664 10:57791622-57791644 CTTGGGGGTTGGAAACAAAATGG + Intergenic
1068522818 10:58095910-58095932 CTTGGGGGTTAGAAGCAAGATGG - Intergenic
1069134522 10:64747054-64747076 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1069265451 10:66452434-66452456 CTTGGGGGTTAGAAGCAAGATGG - Intronic
1069489239 10:68847384-68847406 TTTGGGGATTGGAAGGTAGAAGG + Intronic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069732968 10:70631178-70631200 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069935071 10:71909797-71909819 CTTGGAGGTTAGAGGGAAGATGG + Intergenic
1070510475 10:77156444-77156466 CTTGGAAGTTGGAAGCAAGAGGG - Intronic
1070713439 10:78700281-78700303 CTGGGGGGGTGGGAGGTAGGGGG - Intergenic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071689371 10:87799537-87799559 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1071766655 10:88673899-88673921 CTGGGGTGATGGAAGGATGCTGG - Intronic
1072390979 10:94986698-94986720 GTTGGGGGTTGGGAGGTAGACGG + Intronic
1072808969 10:98445225-98445247 CTGGGGCTTTGGGAGGCAGATGG - Intronic
1073320261 10:102611915-102611937 TTTGGGGGCTGGAAGGGAGAGGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073442421 10:103560257-103560279 CTGGGGGGCTGGAAGGACTGGGG + Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075458020 10:122597487-122597509 CTGGGGTGTTGGAAGGAGTGAGG - Intronic
1075726032 10:124611394-124611416 CTTGGAGGATGGAAGGGAGAGGG + Intronic
1076063474 10:127430588-127430610 CTGGGGGGTGGGGCAGAAGATGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076099754 10:127766658-127766680 CTTGGAGGTTGGAAGCAAGATGG + Intergenic
1076100919 10:127777390-127777412 CTTGGAGGTTAGAAGCAAGAAGG + Intergenic
1076191602 10:128487224-128487246 CTGGGAAGTGGGAAGTAAGAGGG + Intergenic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076653320 10:132004867-132004889 CTTGGAGGTTAGGAGGAAGATGG - Intergenic
1077089033 11:770007-770029 CGGGGAGGTGGGCAGGAAGAAGG + Exonic
1077363664 11:2152539-2152561 CCGTGAGGTTGGAAGGGAGAGGG - Intronic
1077376015 11:2205427-2205449 TAGGGAGGTTGGAAGGCAGAGGG - Intergenic
1077376086 11:2205641-2205663 TGGGGAGGTTGGAAGGCAGAGGG - Intergenic
1077927217 11:6693761-6693783 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1078244752 11:9563895-9563917 TTGGATGGTTGGAAGCAAGATGG - Intergenic
1078303523 11:10159157-10159179 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078369224 11:10731252-10731274 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1078410008 11:11106888-11106910 CTTGGAGGTTGGAAGCAAGATGG - Intergenic
1078447356 11:11414387-11414409 CTGGAGGGTGGTAAGGAAGCGGG - Intronic
1078751199 11:14165199-14165221 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1078835748 11:15027498-15027520 CTTGGGGGTTAGAAGCAAGATGG + Intronic
1078846043 11:15119283-15119305 GTGGGGGGTTGAAAGACAGAGGG - Intronic
1079613029 11:22456844-22456866 CATGGAGGTTAGAAGGAAGATGG - Intergenic
1080291190 11:30673602-30673624 TTGGGGGGTTGGAGCCAAGATGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081075798 11:38672268-38672290 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
1082799275 11:57402409-57402431 CTGAGGGGCTGGCAGGAAAAAGG + Intronic
1082867566 11:57913640-57913662 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1082950766 11:58813326-58813348 CTTGGAGGTTAGAAGGAACATGG + Intergenic
1083197532 11:61097632-61097654 ATGGGCAGTTGGAAGAAAGATGG - Intergenic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083351377 11:62031466-62031488 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1083358635 11:62087920-62087942 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083583581 11:63840127-63840149 CTGGTGGGTTGCAAGCAAGAGGG - Intronic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1084422383 11:69066801-69066823 CTGGAGGCTTGGTAGGCAGAGGG + Intronic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085464260 11:76713458-76713480 CTGGTGGGTAGGCAGGTAGATGG + Intergenic
1085467413 11:76733686-76733708 ATGGGTGGATGGAAGGCAGATGG + Intergenic
1085505749 11:77057887-77057909 CTGGGAGGTTAGAAGCAAGGTGG + Intergenic
1086052992 11:82616103-82616125 TTGGCGGGTTGAAAGCAAGAAGG - Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086391627 11:86371038-86371060 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1086418973 11:86619038-86619060 ATGGCGGGTTGGGGGGAAGAAGG - Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1086923437 11:92613897-92613919 CTGGGGGGATTAAAGGAAAATGG - Intronic
1087049897 11:93875911-93875933 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1087050476 11:93881836-93881858 CTTGGAGGTTAGAAGCAAGAAGG - Intergenic
1087271517 11:96116626-96116648 CTGCAGGATTGGGAGGAAGAAGG + Intronic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1088081592 11:105923049-105923071 CTGGGGGGTTAGAATGGGGAAGG - Intronic
1088253207 11:107879584-107879606 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1088422907 11:109668533-109668555 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089202497 11:116732845-116732867 CTGGAGGGTAGGAAGCATGAAGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090570697 11:128042047-128042069 TTGGGGGCTGGGAAGGTAGATGG - Intergenic
1090844306 11:130518129-130518151 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1091165389 11:133471187-133471209 CTGGGAGGTTGGAATGACTAGGG + Intronic
1091357154 11:134946019-134946041 CTGAGGTGTAGGAAAGAAGATGG + Intergenic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091661799 12:2389803-2389825 CCGGAGGGTTGGAAGAACGAGGG - Intronic
1092038890 12:5365987-5366009 CCGGGGGTTTGAAAGGAAGGTGG + Intergenic
1092143139 12:6197921-6197943 CTGGAGGGTGGGAAGGAGGCCGG - Intergenic
1092492579 12:8959019-8959041 TTGAGAGGTTGGAAGCAAGATGG - Intronic
1092970362 12:13688140-13688162 GTGGGGCATTGGAAGGAAAATGG - Intronic
1093691411 12:22113826-22113848 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1093708828 12:22306036-22306058 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1093857110 12:24118093-24118115 CTGGGGGGTGGGAAGGGATGAGG + Intergenic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1094041646 12:26125788-26125810 GTGGGGGCTGGGAAGGGAGAAGG + Intronic
1094431009 12:30369089-30369111 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1095215683 12:39544556-39544578 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096012824 12:48235892-48235914 GTTGGAGGTTGGAAGCAAGATGG - Intergenic
1096103047 12:48980806-48980828 CCGGAGGCTTGGAACGAAGACGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096747694 12:53739174-53739196 GTGGGAGGTGGGCAGGAAGAGGG + Intergenic
1096789060 12:54034025-54034047 AGGGGGGGTTGGGGGGAAGAGGG - Intronic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1098315537 12:69188695-69188717 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1098408678 12:70154602-70154624 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1098666171 12:73165737-73165759 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1098896733 12:76071274-76071296 CTGGGAGGGTGGAAGTCAGAGGG - Intronic
1100223620 12:92533825-92533847 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1100246076 12:92758214-92758236 TTGGGAGGTAGGTAGGAAGAGGG - Intronic
1100407518 12:94284386-94284408 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100927403 12:99565377-99565399 TTGGGGGGTTTGAAGAAGGATGG - Intronic
1101049299 12:100844589-100844611 CTGTGGGGTGGTAAGGTAGAGGG + Intronic
1101149579 12:101872309-101872331 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1101662043 12:106774605-106774627 CTGGCGGGTTGGAGGCAGGACGG + Intronic
1101787164 12:107894037-107894059 CTGCGGGGTTGGAAAGAGGGTGG - Intergenic
1101912555 12:108871322-108871344 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1101965382 12:109278917-109278939 CTGGGAGGTAGGGAGGGAGAAGG + Exonic
1102026453 12:109716498-109716520 TTGGGGGCTTGGCAGGGAGATGG + Intronic
1102543428 12:113638296-113638318 CTGGGGGGAGGGAAGCAACAGGG + Intergenic
1102723258 12:115035820-115035842 CTGGAGGGAGGGAAGGAAGGGGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103239011 12:119397997-119398019 GTGGGGGGATGGGAGGAAGGGGG + Intronic
1103243180 12:119432051-119432073 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1103246165 12:119459410-119459432 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1103681489 12:122697489-122697511 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1103683217 12:122710920-122710942 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1103868220 12:124070878-124070900 CTTGGAGGTTGGAAGCAAGATGG + Intronic
1103965505 12:124636745-124636767 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104128263 12:125868033-125868055 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1104349367 12:128031465-128031487 CTTGGAGGTTGGAACCAAGATGG - Intergenic
1104355568 12:128082262-128082284 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104694964 12:130856251-130856273 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104852790 12:131885615-131885637 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1104861459 12:131926427-131926449 CGGGGCGGTTGGCAGGCAGAGGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106005910 13:25770056-25770078 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1106217449 13:27715828-27715850 GCTGGGAGTTGGAAGGAAGATGG + Intergenic
1106288854 13:28342244-28342266 CTGGGGAGTAGGAAGGACTAGGG + Intronic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1106672796 13:31925061-31925083 TTGGGGGGTTGAAAGGAATGTGG - Intergenic
1107299553 13:38950557-38950579 CATGGAGGTTGGAAGCAAGATGG + Intergenic
1107664577 13:42675557-42675579 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1107698289 13:43022105-43022127 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1107949262 13:45447042-45447064 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1109163046 13:59000285-59000307 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1109359644 13:61279561-61279583 CTGGGAGGTTAAAAGCAAGATGG - Intergenic
1109411874 13:61981199-61981221 CTTGGGGGTGAGAAGCAAGATGG - Intergenic
1109601945 13:64642829-64642851 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1109698627 13:65994829-65994851 TTTGGGGGTTAGAAGCAAGATGG + Intergenic
1109713219 13:66185404-66185426 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1109909871 13:68895347-68895369 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1110002610 13:70224126-70224148 CTGCAGGCTTGAAAGGAAGATGG + Intergenic
1111249680 13:85586854-85586876 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1112019768 13:95361502-95361524 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1112697661 13:101968903-101968925 CTGGGGGTTTGGAAGCAGGGAGG + Intronic
1112814206 13:103252566-103252588 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1113614673 13:111671701-111671723 ATGGGGGTTTGGCAGGAGGAGGG + Intronic
1113620142 13:111756615-111756637 ATGGGGGTTTGGCAGGAGGAGGG + Intergenic
1114220175 14:20689337-20689359 CTGGCAGGTTGAAGGGAAGAAGG + Intronic
1114256900 14:21010847-21010869 CTGGGGGCTTGGAATGTAAATGG + Intergenic
1114446579 14:22793335-22793357 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1115309347 14:31963931-31963953 ATGGAGGGTGGGGAGGAAGAGGG - Intergenic
1115816224 14:37167425-37167447 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1115879750 14:37902080-37902102 CTGGTGGGTTGTAAGGAGAACGG - Intronic
1115893274 14:38056623-38056645 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1116119142 14:40699702-40699724 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1116343539 14:43757252-43757274 TCGGGGGGTTGGATGGAAGGAGG + Intergenic
1116468058 14:45255715-45255737 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1117077689 14:52121256-52121278 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1117252045 14:53947938-53947960 CTGGGGGGTTGGAGGGGTGGGGG + Intergenic
1118104868 14:62647126-62647148 ATGGAGGGATTGAAGGAAGACGG - Intergenic
1118209643 14:63753429-63753451 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1118454072 14:65929441-65929463 CTGGGGGGTCGAAAGGGAGCTGG + Intergenic
1118510625 14:66468401-66468423 CTTGGAGGTTAGAAGTAAGATGG + Intergenic
1118921340 14:70152540-70152562 CCTGGGGGTTAGAAGGGAGAGGG - Intronic
1118937733 14:70302818-70302840 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1119002631 14:70896679-70896701 AAGGGGGGAAGGAAGGAAGAGGG + Intergenic
1119435803 14:74597163-74597185 CATGAGGGTTTGAAGGAAGATGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120004697 14:79343384-79343406 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1120056437 14:79929771-79929793 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1120694781 14:87632613-87632635 CTTGGAGGATGGAAGCAAGATGG - Intergenic
1120750737 14:88195692-88195714 CTGGGGTTTTGGAAGTAGGATGG - Intronic
1120970639 14:90204246-90204268 CTTGGAGGTTGGAAGCAAGATGG + Intergenic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1121291161 14:92776699-92776721 CTGGGGTGGGGGAAGGAATATGG + Intergenic
1121403538 14:93703689-93703711 GTGGAGGGTTGGAAGGAATATGG + Intronic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1122186792 14:100005128-100005150 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1122434205 14:101681974-101681996 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1122646817 14:103200093-103200115 CTTGGAGGTTGGAGGCAAGATGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123040718 14:105489209-105489231 TTGGGGGGTGGAAAGGAGGAAGG - Intronic
1123735310 15:23178300-23178322 GTGGGGGGTGGGGAAGAAGAGGG - Intergenic
1123899082 15:24858316-24858338 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1124038203 15:26076276-26076298 ATGGGAGGTTGGAAGGTAGGAGG + Intergenic
1124096462 15:26653041-26653063 GTTGGAGGTTGGAAGCAAGATGG - Intronic
1124296878 15:28512055-28512077 GTGGGGGGTGGGGAAGAAGAGGG + Intergenic
1124438994 15:29673811-29673833 CTTGGGGGTTGGAAGCAAGATGG + Intergenic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1124641042 15:31396948-31396970 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1125029406 15:35061283-35061305 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1125095216 15:35842691-35842713 CTGGGGGGTGGTGAGGGAGAAGG - Intergenic
1125338109 15:38647952-38647974 GTGGGGAGTTGCAAGGAGGAGGG + Intergenic
1125537896 15:40453080-40453102 CTGTCGGGTTGGAAGGATGGGGG + Intronic
1125546875 15:40512382-40512404 CTGGGGTGTTGGAAGGAGATTGG - Intergenic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125631401 15:41150562-41150584 CTTGGGGGTTAGAAGCAAGATGG - Intergenic
1125770948 15:42165598-42165620 CTTGGGGATTGGAAGGATGAGGG - Intronic
1126072446 15:44876718-44876740 CTTGGAGGTTAGAAGCAAGACGG + Intergenic
1126085744 15:45009934-45009956 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1126568222 15:50123219-50123241 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1126842773 15:52733543-52733565 CTGTTGGGTGGGAAGGCAGAGGG + Intergenic
1126949983 15:53870411-53870433 GTGGGGGGTGGGAAGGAAAAAGG - Intergenic
1127332266 15:57950808-57950830 GTGGAGGGAGGGAAGGAAGAAGG + Intergenic
1127334314 15:57968451-57968473 CTGGGAGGAAGGAAGGGAGAAGG - Intronic
1128350991 15:66888405-66888427 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1128351826 15:66895905-66895927 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128641148 15:69338747-69338769 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1128784806 15:70386958-70386980 AGGGGGGCGTGGAAGGAAGAAGG + Intergenic
1129149570 15:73679585-73679607 CTGGTGAGTCGGAAGGAAGGTGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129378398 15:75149876-75149898 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1129381234 15:75168664-75168686 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129694141 15:77731104-77731126 CTGGGGGGCTGGAAGGTACCCGG - Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130103990 15:80915366-80915388 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131540611 15:93272060-93272082 CAGCGGGGTTGGAATGAAGCAGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132851947 16:2028772-2028794 CTGGGAAGTGGGCAGGAAGAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133326623 16:4945902-4945924 CTTGGGCGTTGGACAGAAGATGG - Intronic
1133645826 16:7763670-7763692 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1133694126 16:8244539-8244561 CTCGGAGGTTAGAAGCAAGATGG + Intergenic
1133764925 16:8831223-8831245 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1134392607 16:13833357-13833379 CTTGGTGGTTAGAAGGAAGATGG - Intergenic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134504707 16:14795471-14795493 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1134575866 16:15333438-15333460 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1134599805 16:15524428-15524450 CTGGGAGGTGGGGAGGAAGGTGG + Intronic
1134606372 16:15574507-15574529 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1134726578 16:16423063-16423085 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1134940854 16:18288796-18288818 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
1135527712 16:23226830-23226852 CTGGGGGCTTCAAAGGAGGAAGG - Intergenic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1136598698 16:31269508-31269530 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1136934072 16:34442796-34442818 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1136970500 16:34969018-34969040 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1137460290 16:48655230-48655252 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1137617459 16:49856151-49856173 GCGGGGGGTTGGGAGGAGGAGGG - Intronic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138544953 16:57712162-57712184 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1138600564 16:58051605-58051627 CCGGAGGGAGGGAAGGAAGAAGG + Intergenic
1138679740 16:58676165-58676187 CTGGGGGGAAGGATGGAACAGGG - Intronic
1138700142 16:58854057-58854079 CGGGGAGATTGGAAGGAAGTTGG + Intergenic
1138818859 16:60234303-60234325 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139187262 16:64821554-64821576 TTGGAGGGTTTTAAGGAAGAGGG - Intergenic
1139486622 16:67260572-67260594 CTGAGCGGTGGGAAAGAAGAGGG + Intronic
1140128810 16:72139530-72139552 CTGTGGGGTAGGTAGGGAGAAGG + Intronic
1140253527 16:73315875-73315897 CCTGGGAGTTGCAAGGAAGAAGG + Intergenic
1140458917 16:75122823-75122845 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1140642326 16:76990558-76990580 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141155380 16:81593370-81593392 CTGGGGGGTTGGAGGGCGGGGGG + Intronic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421548 16:83921062-83921084 GTGGGTGGAAGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1142539572 17:647666-647688 GTGAGGGGTAGGAAGGATGAGGG + Intronic
1142613905 17:1124173-1124195 CGGGGGGGCTGGAAGGAGCAGGG + Intronic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143539520 17:7560976-7560998 CTAGGGGGTGGGAATGAAAAGGG - Exonic
1143668595 17:8380764-8380786 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144029542 17:11307029-11307051 CTGGGGGGTTGCGAGAAACAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1144252394 17:13430831-13430853 CTGGTGTGGTGGAAAGAAGAAGG - Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144276438 17:13672844-13672866 CTAGGGGGTTGGAATGATCAAGG - Intergenic
1144472227 17:15554715-15554737 CTGAGGGGTTTGAAGGTAAATGG - Intronic
1144551412 17:16244353-16244375 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1144752327 17:17657780-17657802 GTAGAGGGTTGAAAGGAAGAGGG - Intergenic
1144924247 17:18789982-18790004 CTGAGGGGTTTGAAGGTAAATGG + Intronic
1145910220 17:28537986-28538008 CTGGGCTGTTGGGATGAAGATGG - Exonic
1146103522 17:30009386-30009408 CTGGAGGTTTGGAAGGAAATGGG - Intronic
1146359428 17:32161663-32161685 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1146478131 17:33179632-33179654 CTGTGGGGTTGTAAGGAGGGTGG - Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146602326 17:34228590-34228612 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146809144 17:35889521-35889543 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147230461 17:39014232-39014254 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1147268758 17:39251713-39251735 AGGGAGGGTGGGAAGGAAGAAGG + Intergenic
1147320022 17:39640490-39640512 TTGGGGGGATGGAAGGGAGCCGG - Intronic
1147587461 17:41660612-41660634 CTGGGGGATGGGAAGCAACACGG - Intergenic
1148649893 17:49242679-49242701 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1149201512 17:54191072-54191094 GTTGGGGGTAGGAAGGAAGTGGG - Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149472458 17:56928695-56928717 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1149476834 17:56968519-56968541 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1150125596 17:62632616-62632638 CTGGAAGGTGGGAAAGAAGAGGG - Intronic
1150228804 17:63538692-63538714 GTTGGGGATTGGATGGAAGAGGG + Intronic
1150519386 17:65850391-65850413 CTGGGGGGTGGGAAGTAGGGTGG - Intronic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151383932 17:73743824-73743846 AAGGGGGGAGGGAAGGAAGAGGG - Intergenic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151694153 17:75705589-75705611 CCTGGGGTTTGGAAGGGAGAGGG - Intronic
1151713122 17:75817945-75817967 GTAGGGGGTGGGGAGGAAGAAGG + Intronic
1151751050 17:76037926-76037948 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1152150666 17:78598354-78598376 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1152251827 17:79216431-79216453 CTGGGGGGCAGGCAGGAAGGAGG + Intronic
1152379812 17:79936609-79936631 CTTGGGGGTTGGTCGGGAGAAGG - Exonic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152675594 17:81639076-81639098 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1153100927 18:1468767-1468789 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1153226422 18:2903422-2903444 CTGGGGCGTGGGAAGAAGGATGG - Intronic
1153345436 18:4020617-4020639 CTGAGAGGTTAGAAGCAAGATGG - Intronic
1153641942 18:7165103-7165125 CTGTAGGGTTGTGAGGAAGAGGG - Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155852062 18:30786396-30786418 CTGGGGGGCAGGAAGGGAGTGGG - Intergenic
1155883814 18:31183320-31183342 TAGAGGGGTAGGAAGGAAGAGGG - Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156205555 18:34882289-34882311 AAGGGAGGGTGGAAGGAAGAAGG - Intronic
1156242084 18:35264426-35264448 CTGGGGAGTTGGAATTCAGAAGG - Exonic
1156539374 18:37894420-37894442 CTGGAGGGTTGAAAGGAGGGGGG + Intergenic
1156902783 18:42320940-42320962 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1157601783 18:48897348-48897370 CTAGGGGGTTGGTAGCAAGGAGG + Intergenic
1158285122 18:55872053-55872075 GTGGGGGGCTGGGAGGAAGGTGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158870040 18:61677327-61677349 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159906517 18:74097393-74097415 TTGGGGGGTTGGGAGGATGAGGG + Intronic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1161050741 19:2162974-2162996 CTTGGAGGTTAGAAGGAAGAGGG - Intronic
1161218240 19:3105391-3105413 TTGGGGGGTTGGGGGGAAGGGGG + Intronic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161501926 19:4620945-4620967 CTGGGGGGTTTCAAGAAAGGGGG + Intergenic
1161821246 19:6532182-6532204 CAAGGGGGCTGGAAAGAAGAGGG + Intronic
1161870679 19:6867426-6867448 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1162035884 19:7939004-7939026 CCAGGGGTTTGGTAGGAAGAGGG + Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162641227 19:12011894-12011916 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162818767 19:13210553-13210575 AGGGGGGGTGGGGAGGAAGAGGG + Intronic
1162866097 19:13548153-13548175 ATGGTGGGTGGGATGGAAGAGGG + Intronic
1162881707 19:13664654-13664676 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1163107296 19:15132346-15132368 GTGGGGGGTGGGACGGAAGTGGG - Intergenic
1163196776 19:15727407-15727429 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1163590403 19:18190575-18190597 ATTGGGGGAAGGAAGGAAGAAGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164932503 19:32186456-32186478 CTGGGGGGTTTAGAGGAAGAAGG + Intergenic
1164937027 19:32223039-32223061 AGGGAGGGTGGGAAGGAAGAAGG + Intergenic
1165300616 19:34966190-34966212 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1165998836 19:39865344-39865366 GTGGGTGGATGGAAGAAAGAAGG + Intronic
1166040306 19:40198352-40198374 CTGTGGGGTGGGAAGAAAGGTGG - Intronic
1166102228 19:40577474-40577496 GGGAGGGGTTGGTAGGAAGAGGG + Intronic
1166301445 19:41913934-41913956 CTGGGGGGTCTCCAGGAAGAAGG - Intronic
1166498001 19:43318703-43318725 CTTGGAGGTTAGAAGCAAGACGG + Intergenic
1166571957 19:43802646-43802668 CTGGGAGGGGTGAAGGAAGAAGG - Intronic
1166660594 19:44644303-44644325 CCCCGGGGTTGGAAGGAACACGG + Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166708819 19:44924303-44924325 CTGAGGGGTTGGAAGGGGGCAGG - Intergenic
1166750333 19:45161504-45161526 CTGGGTGGTGGAGAGGAAGACGG - Intronic
1166820726 19:45578060-45578082 CTTGGAGGTTGGAAGTAAGATGG - Intronic
1166821452 19:45583002-45583024 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167787000 19:51645344-51645366 TTGGGGGGTTGGGAGCAGGAAGG + Intronic
1167805852 19:51784726-51784748 CTCGGAGGTTAGAAGCAAGATGG - Intronic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1168108951 19:54181204-54181226 CAGGGAGCTTGGAAGGAAGGTGG + Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168617655 19:57851427-57851449 CTGAAAGGTTGGAAGCAAGATGG + Intronic
1168625600 19:57915575-57915597 CTGAAAGGTTGGAAGCAAGACGG - Exonic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
925942712 2:8836256-8836278 CTGGGGTGGTGGAAGGGAGGAGG - Intronic
925943349 2:8839720-8839742 AGGGGGGGATGGGAGGAAGAGGG - Intergenic
926239345 2:11073110-11073132 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926489936 2:13512881-13512903 CTTGGAGGTTAGAAGTAAGATGG - Intergenic
926698626 2:15787910-15787932 ATGGACGGATGGAAGGAAGATGG - Intergenic
926871470 2:17422632-17422654 CTGTGAGGTTAGAAGTAAGATGG + Intergenic
927560567 2:24069524-24069546 CTGGGTGGTTGGAACACAGATGG - Intronic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
927675632 2:25103830-25103852 CTGGGGGGTGGCAGGGGAGAGGG + Intronic
928199717 2:29239879-29239901 CTGCTGGGTTGGCAGGAAGGGGG - Intronic
928296458 2:30088396-30088418 CTTGGAGGTTGGAAGCAAGATGG - Intergenic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
928671314 2:33606359-33606381 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
929265267 2:39912047-39912069 CTGTGGGCTTGGGAGTAAGATGG + Intergenic
929385326 2:41399883-41399905 ATGGGGTGTTGGATGGAAAAGGG - Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929535132 2:42777533-42777555 CTTGGAGGTTAGAAGCAAGATGG + Intronic
929550797 2:42890364-42890386 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
929879042 2:45820883-45820905 CTGGGGGGTGGGAAGGGGGTGGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929928597 2:46234906-46234928 CTTGGGGGTTAAAAGGAAGTTGG - Intergenic
930167262 2:48215103-48215125 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
930621222 2:53645925-53645947 CTTGGAGGTTAGAAGCAAGATGG - Intronic
930706998 2:54514798-54514820 CTTGGAGGTTAGAAGCAAGATGG - Intronic
930802729 2:55459597-55459619 CTTGGAGGTTGGAGGCAAGATGG - Intergenic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931149118 2:59553346-59553368 ATGGGGAGTTGTAAGAAAGAGGG - Intergenic
931598292 2:63975237-63975259 CTTGGAGGTTAGAAGCAAGATGG - Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
933871921 2:86574954-86574976 TTGGGGTGTGGGAAGGAGGATGG - Intronic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
934087970 2:88526014-88526036 GTGGAGGGTTGTAAGGAACAAGG + Intronic
934155866 2:89199775-89199797 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
934211456 2:89982984-89983006 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934555923 2:95286963-95286985 AGGTGGGGTTGGGAGGAAGATGG + Intronic
934604027 2:95680812-95680834 CTGGGGGGTTAGACGGGAGGGGG + Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
934670933 2:96212274-96212296 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
934701047 2:96440394-96440416 CTTGGAGGTTAGGAGGAAGATGG - Intergenic
934706433 2:96484837-96484859 GTGGAGGGTAGGAGGGAAGATGG - Intergenic
935122565 2:100195835-100195857 TAGGGGAGTTGGAAGGAGGAGGG + Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935162577 2:100542007-100542029 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
935639384 2:105276328-105276350 CTTGGGGGTAGAAAGGATGACGG + Intronic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935957773 2:108395422-108395444 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937134771 2:119543240-119543262 CTGGTGGGTTAGAAGGAGGGTGG + Intergenic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937544404 2:122999519-122999541 CTCGGAGGTTAGAAGTAAGATGG - Intergenic
937651892 2:124328487-124328509 CTGGGGTGTGAGAAGGGAGAAGG - Intronic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938316707 2:130334416-130334438 CTGGGGGGCTGGGAGGATTATGG - Intergenic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
938973460 2:136453099-136453121 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
939042653 2:137209132-137209154 CTTGGAGGTTAGAAGCAAGATGG + Intronic
939255637 2:139742037-139742059 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
940110537 2:150147661-150147683 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
940194997 2:151084028-151084050 CTGGGGAGTTGGAATGGAGGCGG + Intergenic
940612878 2:156012079-156012101 CTTGGAGGTTAGAAGTAAGATGG + Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941673747 2:168322144-168322166 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
941877425 2:170448269-170448291 CTTGGAGGTTAGAAGGAAGATGG + Intronic
941912071 2:170773299-170773321 CTAGGAGGTTAGAAGCAAGATGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
941960338 2:171246928-171246950 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942223687 2:173796194-173796216 CTTGGTGGTTAGAAGCAAGATGG - Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943284496 2:185980344-185980366 CTTGGGGGTCAGAAGCAAGATGG + Intergenic
943646754 2:190414114-190414136 CTGGGGGGTTGGGTGGCAGGGGG + Intronic
943665324 2:190602867-190602889 CTGAAAGGTGGGAAGGAAGAGGG + Intergenic
943748383 2:191486065-191486087 CTGGGAAATTGGAAGGAAAATGG + Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
945846976 2:214957311-214957333 CTGAGGAGTTTGCAGGAAGATGG + Intronic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946224958 2:218259536-218259558 CTGGTGGGTCGGAAGGACGCAGG - Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946596349 2:221309879-221309901 CGGGGGGATTGCAAGGAAGGTGG - Intergenic
946806851 2:223479556-223479578 GTGGAGGGTAGGAAGGAAAAGGG + Intergenic
946954806 2:224917554-224917576 GTTAGGGGTGGGAAGGAAGAAGG + Intronic
947163705 2:227240275-227240297 CCAGGGGGTAGGCAGGAAGAGGG - Intronic
947179883 2:227402484-227402506 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
947519234 2:230831000-230831022 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
947519962 2:230837991-230838013 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
947619600 2:231581111-231581133 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
947802752 2:232941498-232941520 CTTGGAGGTTAGAAGGAAGATGG + Intronic
947895115 2:233663766-233663788 CTTGGAGGTTAGAAGCAAGATGG + Intronic
948006632 2:234614918-234614940 CTTGGAGGTTAGAAGGAAGATGG - Intergenic
948032306 2:234828829-234828851 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
948762331 2:240199722-240199744 CTGGGGGGCGGGAAGGCAGCCGG - Intergenic
1168941857 20:1719503-1719525 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1169324700 20:4665781-4665803 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1169455164 20:5746262-5746284 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1170024235 20:11871781-11871803 CTTGGGGGTAGAAAGGAATAAGG - Intergenic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170223418 20:13964952-13964974 ATAGGGGGTTAGAAGGAAGAAGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170466142 20:16623978-16624000 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171343000 20:24445186-24445208 CTTGGGAGTGGGTAGGAAGAGGG - Intergenic
1171417628 20:24994069-24994091 ATGGGGGGTGGGGAGCAAGAGGG - Intergenic
1171475553 20:25406082-25406104 CTTGGCGGTTAGAAGCAAGATGG + Intergenic
1172664063 20:36587055-36587077 TTGGGGAGATGGTAGGAAGAAGG - Intronic
1172780171 20:37431943-37431965 GTGGAGGGTTGGATGGAGGAAGG - Intergenic
1172834215 20:37862658-37862680 CAGAGGGGTGGGAATGAAGATGG - Intronic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1173508336 20:43607112-43607134 CTGGGTGGTTGCCAGGCAGAGGG + Intronic
1173862723 20:46294711-46294733 GTGGGGGCTTGGGAGAAAGAGGG + Intronic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174870143 20:54174110-54174132 GAGGGGGGGTGGAAGGAGGATGG + Intergenic
1175110797 20:56646552-56646574 ATGGGAGGTTTGAAGGAAGCAGG - Intergenic
1175332772 20:58176433-58176455 CTAGGGGGTTGGAAGAAAGTGGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1176843483 21:13858875-13858897 GTTGGGGGGTGGAAGGAAAAGGG - Intergenic
1177281069 21:18983963-18983985 CTTGGAGGTTGGAAGCAAGATGG - Intergenic
1177403065 21:20631185-20631207 CTCGGAGGTTAGAAGCAAGATGG + Intergenic
1178382390 21:32121595-32121617 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1178882802 21:36462187-36462209 CTGGGCGGTTGTCAGGATGAGGG + Intronic
1179062364 21:37990772-37990794 ATCGGGGGGTGGGAGGAAGAGGG - Intronic
1179430803 21:41319807-41319829 TTGGGGGGTTGGCAGGGGGAAGG - Intronic
1179640248 21:42743103-42743125 CTTGGAGGTTCGAAGCAAGATGG + Intronic
1179672893 21:42962181-42962203 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180966287 22:19789490-19789512 GTGGGGGGTTGGCAGGATGAGGG + Intronic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181259982 22:21590836-21590858 CTGGGGCTTTGGGAGGAAAAAGG - Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181503682 22:23335955-23335977 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1181570943 22:23767594-23767616 CTGCGGGGGTGGGAGGAAGCAGG + Intronic
1181644073 22:24221101-24221123 CTGGGAGGTTAGAAGCAAGATGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181654250 22:24282433-24282455 CTGGGAGGTTAGAAGCAAGATGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181708678 22:24666182-24666204 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1182249921 22:28992156-28992178 GCGGGGGGTTGGGGGGAAGAGGG - Intronic
1182500115 22:30740588-30740610 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1183095257 22:35548104-35548126 CAGGGAGGTTGGGGGGAAGAAGG + Intronic
1183226152 22:36551283-36551305 ATGGGGGGATGGATGGATGACGG - Intergenic
1183287350 22:36975667-36975689 CTGTGAGGTTAGAAGCAAGACGG - Intergenic
1183375013 22:37458252-37458274 CAGGGGGCTGGGGAGGAAGATGG + Intergenic
1183477111 22:38041725-38041747 CTGGGGGCTGGGAAGGATCATGG + Intronic
1184247866 22:43244826-43244848 CTGAGGGGCAGGGAGGAAGAAGG - Intronic
1184744630 22:46449167-46449189 ATGGGTGGTTGGATGGAAGCTGG - Intronic
1185405688 22:50648040-50648062 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949335259 3:2967599-2967621 CTTGGAGGTTAGAAGCAAGATGG + Intronic
949535668 3:4994682-4994704 TTGGGGAGATGGAAGGAAGCTGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949777335 3:7647557-7647579 ATGGGGAGTTGGAAGTATGAGGG + Intronic
949997634 3:9631017-9631039 CTTGGTGGTTAGAAGCAAGATGG + Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950626544 3:14251626-14251648 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
950797433 3:15521389-15521411 GAGGGAGGTTGGAAGGAAGACGG - Intronic
951074237 3:18369710-18369732 ATGGGGGGGTGGGAGGAAAAAGG + Intronic
951369319 3:21826024-21826046 GTGGGGGGTTGAGGGGAAGAAGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952108593 3:30096639-30096661 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
953201276 3:40780564-40780586 CTGGATGTTTGGGAGGAAGAAGG + Intergenic
953437800 3:42892989-42893011 CTTGGAGGTTGGAAGCAAGATGG + Intronic
953500020 3:43424260-43424282 CTTAGAGGTTGGAAGCAAGATGG - Intronic
953613460 3:44468318-44468340 CTTGGAGGTTAGAAGCAAGATGG - Intronic
953683107 3:45054332-45054354 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
953922151 3:46959706-46959728 CAGGGAGGTGGCAAGGAAGAAGG + Intronic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954291417 3:49652028-49652050 CTGGGGGCTGGGGTGGAAGAGGG - Exonic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954590719 3:51779126-51779148 GTGGGGGATTGGAAACAAGATGG - Intronic
954592723 3:51797393-51797415 CTTGGAGGTTCGAAGCAAGATGG + Intergenic
955605826 3:60701920-60701942 CTTGGAGGTTAGAAGCAAGATGG + Intronic
955858280 3:63298220-63298242 CTTGGAGGTTAGAAGCAAGATGG + Intronic
955911709 3:63864308-63864330 CTGGGGGGTGGGGAGGGTGACGG + Intergenic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
957284697 3:78203425-78203447 CTGGGGGGTTGGGTGGAAAGGGG - Intergenic
957343109 3:78926504-78926526 CTGGAGGGTTGGATGGATAATGG + Intronic
958628258 3:96654937-96654959 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
959137145 3:102437461-102437483 CTTGGGTTTTGGAAGGAAAATGG - Intronic
960006542 3:112787069-112787091 CTTGGAGGTTAGAAGCAAGATGG - Intronic
960135184 3:114097447-114097469 CTTGGTGGTTAGAAGCAAGATGG + Intergenic
960262372 3:115582352-115582374 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
960609509 3:119542648-119542670 CTTGGAGGTTAGAAGCAAGATGG - Intronic
960823920 3:121762495-121762517 CTGGAGGGTTGGGAGGAATAGGG - Intergenic
961384583 3:126516503-126516525 CTGGGGGGTGGGAGGGTAGGTGG - Intronic
961718770 3:128878269-128878291 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
961870200 3:129982001-129982023 CTGAAGAGTTGGAAGGAAGTAGG - Intergenic
962671041 3:137708931-137708953 CAGGGGTGTTGGAAAGAGGATGG + Intergenic
962694297 3:137932328-137932350 CTGGGGAGTTGGATGGAATCAGG - Intergenic
962768228 3:138586689-138586711 CAGGTGGGCTGAAAGGAAGAGGG + Intronic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963171685 3:142257527-142257549 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
963314197 3:143741831-143741853 CTTGGAGGTTAGAAGAAAGATGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963627722 3:147694109-147694131 TTGGGGGGTGGGAAGGAAACTGG - Intergenic
963718127 3:148827923-148827945 TTGGGGGCTAGCAAGGAAGAAGG - Intronic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
964010649 3:151887660-151887682 CTTGGTGGTTAGAAGCAAGATGG + Intergenic
964011608 3:151898711-151898733 CTTGGTGGTTAGAAGCAAGATGG - Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964215824 3:154280672-154280694 ATGGGGGGTGAGAAGGTAGAGGG + Intronic
964320609 3:155492806-155492828 TTTTGGGGTTGGCAGGAAGAGGG + Exonic
964366304 3:155954049-155954071 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
964398028 3:156268014-156268036 ATGGGGGGTGGGGAGGAAGTGGG - Intronic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
964729223 3:159847155-159847177 ATGGGGGGTGGGAAGGAAATGGG + Intronic
964921181 3:161897703-161897725 CTTGGAGGTTAGAAGTAAGATGG - Intergenic
965805554 3:172537974-172537996 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
965945063 3:174231099-174231121 CTTGGAGGTTAGAAGCAAGAGGG + Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966934911 3:184699863-184699885 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
967122920 3:186399588-186399610 CTGGGAGGGTGGGATGAAGAAGG + Intergenic
967180425 3:186898397-186898419 CTGCTGGGGTGTAAGGAAGATGG - Intergenic
967210089 3:187160608-187160630 CTTGGAGGTTAGAAGCAAGATGG + Intronic
967220275 3:187242720-187242742 CTGGGGGTTTGGGAGGAACTGGG - Intronic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
967364525 3:188670769-188670791 CTGAAAGGTTGGAAGGATGACGG + Intronic
967915549 3:194575702-194575724 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
968290898 3:197539034-197539056 CTTGGAGGTTAGAAGCAAGATGG - Intronic
968573383 4:1353957-1353979 CAGGGGGCTTGGGAGGAAGCTGG - Intronic
968771023 4:2507186-2507208 CTGGAAGGAAGGAAGGAAGAGGG + Intronic
969088555 4:4675117-4675139 GTAGGTGTTTGGAAGGAAGAAGG - Intergenic
969205430 4:5640386-5640408 GTGGGTGGTTGGATGGATGATGG + Intronic
969254414 4:5992595-5992617 ATGGGGGGTGGGGAGGAAGGGGG - Intergenic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969552110 4:7876958-7876980 CTGGAAGGCTGGAAGAAAGAGGG - Intronic
969576604 4:8039576-8039598 GTGGAGTGTGGGAAGGAAGAAGG - Intronic
969577020 4:8042183-8042205 AGCGGGGGTAGGAAGGAAGAGGG - Intronic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970190934 4:13516871-13516893 CTGGTGGGTGGTAAGGTAGAGGG + Intergenic
970579458 4:17461492-17461514 CTTGGAGGTTAGAAGCAAGATGG + Intronic
970956965 4:21824140-21824162 CTTGGAGGTTAGAAGCAAGATGG - Intronic
971410809 4:26369847-26369869 CTGGTAGGTTGGAAGAGAGAGGG - Intronic
971846791 4:31928834-31928856 CTTGGAGGTTCGAAGCAAGATGG - Intergenic
971851795 4:31993894-31993916 CTTGGAGGTTAGAAGCAAGACGG + Intergenic
971968777 4:33594968-33594990 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
972147462 4:36045532-36045554 CTGGGGGGTTGGAAAGAATGAGG + Intronic
972565402 4:40264970-40264992 TTGAGAGGTTTGAAGGAAGATGG + Intergenic
973245650 4:48008745-48008767 CTTGGAGGTTAGAAGCAAGATGG - Intronic
973249053 4:48042407-48042429 CTTGGAGGTTGGAAGCAAGATGG + Intergenic
973252880 4:48079101-48079123 CTTGGAGGTTAGAAGCAAGATGG - Intronic
973641600 4:52908400-52908422 CTGGAGGATTGGGAGGAAGGTGG - Intronic
974166839 4:58214892-58214914 ATGGGGAGTGGGAAGGACGATGG + Intergenic
974321170 4:60352514-60352536 ATGGGGTGGGGGAAGGAAGAAGG - Intergenic
975197354 4:71541365-71541387 CTGGATGGTGTGAAGGAAGAAGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975780387 4:77833192-77833214 GTGGGGGGTGGGGAGGAAGTGGG - Intergenic
975801037 4:78058980-78059002 CCGGCGGGCTGGGAGGAAGACGG + Intronic
975916503 4:79331669-79331691 CTGGGAGGTTAGAAACAAGATGG + Intergenic
976082344 4:81369518-81369540 TTGGGAGGTTGGGAGGAAGTGGG - Intergenic
976188836 4:82469662-82469684 TTGTGAGGTTAGAAGGAAGATGG + Intergenic
976255503 4:83096210-83096232 CTTGGCGGTTAGAAGTAAGATGG + Intronic
976262168 4:83156031-83156053 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
976302217 4:83525955-83525977 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
976334960 4:83874774-83874796 CTGGGGTGTTACAAGGAGGAGGG + Intergenic
976775232 4:88699222-88699244 CTAGGGGGTGGGGAAGAAGAGGG - Intronic
976884064 4:89964538-89964560 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
978184310 4:105839093-105839115 GTGCGGGGTTGGTAGGAAGAGGG - Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978950419 4:114552315-114552337 CTTAGAGGTTGGAAGCAAGATGG - Intergenic
979308194 4:119172827-119172849 CTTGGAGGTTAGAAGCAAGATGG + Intronic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979480166 4:121207720-121207742 CTTGGAGGTTAGAAGAAAGATGG - Intronic
979591330 4:122483667-122483689 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980270380 4:130576715-130576737 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
980339902 4:131531698-131531720 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
980564277 4:134518336-134518358 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
980669814 4:135990267-135990289 GTGGGGGGTTAGAAGGAAGTGGG - Intergenic
980777363 4:137454014-137454036 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
980829111 4:138108348-138108370 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
981258212 4:142688583-142688605 CTTGGAGGTTAGAAGCAAGATGG - Intronic
981696862 4:147567726-147567748 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
981753876 4:148119919-148119941 CTGAGTGGTTGGATGGATGAAGG + Intronic
982008745 4:151086942-151086964 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
982326100 4:154129391-154129413 CTGGGGGGTATAGAGGAAGATGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982475622 4:155846577-155846599 CTTGGAGGTTAGAAGCAAGATGG + Intronic
982703006 4:158676629-158676651 CTTGGAGGTTAGAAGCAAGATGG + Intronic
983470162 4:168145502-168145524 CTTGGAGGTTAGAAGCAAGATGG + Intronic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983748929 4:171238661-171238683 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
984762715 4:183376713-183376735 CTGGGGGCGGGTAAGGAAGAGGG - Intergenic
985054952 4:186027937-186027959 CTTGGAGGTCGGAAGCAAGATGG + Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985993775 5:3584916-3584938 ATGGGAGGAAGGAAGGAAGAAGG + Intergenic
986241487 5:5964149-5964171 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
986477412 5:8149538-8149560 CAGGGAGGTTGTAAAGAAGAGGG + Intergenic
986939367 5:12931618-12931640 CTAGTGGGTTGGAAGACAGATGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987118724 5:14746760-14746782 CTTGGAGGTTGGAAGCAAGATGG + Intronic
987278025 5:16382922-16382944 CCGGGGTGATGGAAGGCAGAGGG - Intergenic
987388268 5:17351081-17351103 GTGGAAGGTTAGAAGGAAGAAGG - Intergenic
987395124 5:17415868-17415890 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
988419787 5:30991712-30991734 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
988776278 5:34480520-34480542 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
988828720 5:34967423-34967445 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
988854492 5:35214712-35214734 CTGTGAGGTTAGAAGCAAGATGG - Intronic
988882699 5:35520615-35520637 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
989039184 5:37209218-37209240 CTGAGGGGTCGGGAGGAACAAGG - Intronic
989116855 5:37963616-37963638 GGGTGGGGTTGGAAGGAGGAAGG - Intergenic
989169138 5:38457943-38457965 CTGGGGGGAGGGAAGAATGAGGG + Intronic
989388949 5:40880714-40880736 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
989553758 5:42766768-42766790 GTGGGGGGCTGGAAGGGAGGTGG + Intronic
990260130 5:54013332-54013354 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990306428 5:54498095-54498117 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
991027488 5:62045794-62045816 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
991030338 5:62076025-62076047 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
991239861 5:64445296-64445318 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
991276333 5:64851387-64851409 CTGGAGGGGTGGGAGGAATAGGG + Intronic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991496588 5:67232852-67232874 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
991622336 5:68557949-68557971 CTGGAGCCTTGGAAGGGAGAGGG - Intergenic
991936867 5:71810738-71810760 ATGGGGAGTTGGAAGGTAGCAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992017409 5:72589770-72589792 CTGGGGAGTTGGAAGGAGTTGGG + Intergenic
992107347 5:73460908-73460930 CTTGGGGGTTAGAAGCAAGATGG - Intergenic
992292667 5:75295275-75295297 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
993038997 5:82790821-82790843 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
993421999 5:87714302-87714324 CTTGGAGGTTGGAAGCAAGATGG + Intergenic
993422783 5:87722026-87722048 CTGGGAGGTTGGAAGCAAGATGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994014629 5:94951117-94951139 CTGGACAGTTGGAAGGATGAGGG - Intronic
995581667 5:113608628-113608650 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
995596133 5:113749845-113749867 CTTGGAGGTTAGAAGTAAGATGG + Intergenic
995926383 5:117380049-117380071 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
996132304 5:119796228-119796250 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
996132485 5:119798435-119798457 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
996381318 5:122864991-122865013 CTTGGAGGTTGGAAGCAAGATGG + Intronic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
997153574 5:131526723-131526745 CTGGTGGGCTGGAAGGACAATGG - Intronic
997301417 5:132808788-132808810 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
997497612 5:134343356-134343378 CTTGGAGGTTAGAAGCAAGATGG - Intronic
998093798 5:139385670-139385692 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
998167702 5:139853780-139853802 GTGGGGGGTTGGGAGGGAGGTGG + Intronic
998350487 5:141497278-141497300 CTGGGGTGGTGGTAGGTAGAGGG - Intronic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998921992 5:147079686-147079708 CTGGGAGGGTGGTAGGAAGATGG + Intronic
999143535 5:149378294-149378316 CTTGGGGGATGGCTGGAAGAGGG - Intronic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999358531 5:150960419-150960441 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
999414300 5:151381376-151381398 CTTGGGGGTTAGAAGCAAGATGG - Intergenic
999806033 5:155082148-155082170 CTGAGAGGTTAGAAGCAAGATGG + Intergenic
999832282 5:155332075-155332097 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
999898057 5:156056174-156056196 CTTGGAGGTTAGAAGTAAGATGG - Intronic
1000017875 5:157294304-157294326 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000831756 5:166110822-166110844 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1000848011 5:166305291-166305313 CTTGGAGGTCGGAAGCAAGATGG + Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1001523544 5:172412886-172412908 TTGGGGAGTAGGAAGGGAGAAGG + Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003267913 6:4582754-4582776 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1003693097 6:8374238-8374260 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1004257574 6:14079120-14079142 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1004368426 6:15031402-15031424 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1004390337 6:15204450-15204472 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1004445348 6:15692841-15692863 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1004468157 6:15904870-15904892 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1004646463 6:17566517-17566539 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1005303109 6:24490205-24490227 CTTGGGAGGTGGAAGGAAGGGGG + Intronic
1005327762 6:24719797-24719819 CTGCGGGGGTGGAAGGCAGGTGG - Exonic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005624097 6:27647240-27647262 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
1005641479 6:27800595-27800617 CTTGGAGGTTAGAAGCAAGACGG - Intergenic
1005709190 6:28487081-28487103 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1005748286 6:28860632-28860654 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1005913460 6:30330758-30330780 CTGAGGGGTAGGGAGGAAGTGGG - Intronic
1005968145 6:30742055-30742077 CTGGGAAGTTGGTAGGGAGAGGG + Intronic
1006232474 6:32596197-32596219 CTGGGTGGTTGCCAGGCAGAGGG + Intergenic
1006312395 6:33270131-33270153 CATGGGGGCTGGAAGGAATAAGG - Intronic
1006401376 6:33819621-33819643 CTGGGGGTTTGGAAGGGAAGAGG + Intergenic
1006710816 6:36068712-36068734 GTGGGAGGTGGGGAGGAAGAGGG + Intronic
1006839920 6:37022174-37022196 CTGGGAGGATGGGCGGAAGAAGG + Intronic
1007210109 6:40186662-40186684 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1007317146 6:40998362-40998384 ATGGGGTGTGGGGAGGAAGATGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007467035 6:42059763-42059785 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1007539167 6:42625058-42625080 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1007755585 6:44097266-44097288 CTGGGGTGTTGGAGGGAACTTGG - Intergenic
1007766205 6:44161775-44161797 CTGGGGGCCTGGAAGGACCAGGG - Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008497259 6:52145714-52145736 TTGGGGGGGTGGAAGGAACTTGG + Intergenic
1009625760 6:66137511-66137533 CTTGGAGGTTAGAAGTAAGATGG - Intergenic
1010316050 6:74451988-74452010 ATGGGGAGCTGGAAGGAAAATGG - Intergenic
1010366815 6:75060602-75060624 CTAGGGGGAAGGAAGGAAAAAGG - Intergenic
1010573605 6:77507135-77507157 CTAGGGGGTTGAAAGGAGAATGG + Intergenic
1011181303 6:84624457-84624479 CTGGTGGGATGGAAGGCAGGAGG - Intergenic
1011507014 6:88056428-88056450 ATGGAAGGATGGAAGGAAGAAGG - Intronic
1011824865 6:91293889-91293911 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1011878157 6:91988604-91988626 GTGGGGGGTTGGGAGGGAGGTGG + Intergenic
1011939815 6:92828893-92828915 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1012212080 6:96531608-96531630 CTGGGTGGTAGGAATGGAGAGGG + Intronic
1013591190 6:111620694-111620716 CTTGGGGGAACGAAGGAAGAAGG - Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013761011 6:113518067-113518089 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014274344 6:119369692-119369714 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1014977964 6:127912413-127912435 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1015155332 6:130088656-130088678 CTGGGGAGTGGGAAGGAATGAGG - Intronic
1015173204 6:130277805-130277827 CTTGGAGGTTAGAAGCAAGAAGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015886782 6:137926032-137926054 CTGGGGGTTAGGGAGGAAGTGGG - Intergenic
1016521381 6:144950700-144950722 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016739858 6:147515417-147515439 ATGGATGGTTGGATGGAAGACGG - Intronic
1016840449 6:148519713-148519735 CTGGGGGGCTGGCCGGAAGTTGG + Exonic
1017011195 6:150064854-150064876 CCTGGGGGTAGGAAGGGAGAAGG + Intronic
1017609841 6:156173900-156173922 CTTGGAGGTTAGAAGCAAGACGG - Intergenic
1017837193 6:158189242-158189264 CTGGGGGTTTCTATGGAAGAGGG - Intronic
1017921859 6:158879789-158879811 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1018124302 6:160667229-160667251 GTGGAGGGTTGGAAGCAAGAGGG - Intergenic
1018193092 6:161328175-161328197 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019197377 6:170290423-170290445 CTCGGGGGCTGGGAGGAAGGAGG - Exonic
1019782431 7:2951390-2951412 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020270050 7:6589658-6589680 CTGGGGGGTACGGGGGAAGATGG - Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020475087 7:8584702-8584724 CTGGGGGATCGGAATGGAGATGG + Intronic
1020991273 7:15199106-15199128 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1021245174 7:18252912-18252934 CTGGGGTGGAGGATGGAAGAGGG - Intronic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1021650142 7:22824928-22824950 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1023436962 7:40149305-40149327 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1023461885 7:40406520-40406542 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1023736696 7:43241913-43241935 GTGGGGGGTGTGGAGGAAGAAGG + Intronic
1023753644 7:43395342-43395364 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1023800730 7:43832223-43832245 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1023802213 7:43845018-43845040 TTGTGAGGTTGGAAGCAAGATGG - Intergenic
1023963001 7:44943258-44943280 CTAGGGGTTTGGAAAGAAGAGGG + Intergenic
1024002672 7:45201291-45201313 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1025737296 7:64162042-64162064 CAGGGAGATTGGAAGCAAGATGG + Intronic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1025943094 7:66087706-66087728 CTGGGGGGGTGGGAGGAAGCAGG - Intronic
1026190224 7:68118935-68118957 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1026205827 7:68256342-68256364 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1026251290 7:68673320-68673342 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026459590 7:70602018-70602040 CTGGGGGGTTGGGATGGACATGG - Intronic
1026475379 7:70730411-70730433 CTGAGGGATTGGGAGGATGAGGG - Intronic
1026495217 7:70895886-70895908 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1026799549 7:73390926-73390948 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027202363 7:76072071-76072093 CTGGGAGGCTGGCAGGAACACGG + Intergenic
1027407651 7:77878677-77878699 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1027579834 7:79978402-79978424 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1027974936 7:85140888-85140910 CTGAGGTGTTGATAGGAAGATGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028557341 7:92138089-92138111 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028740487 7:94268742-94268764 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029540841 7:101180986-101181008 CTGGTGGCTGGGGAGGAAGAGGG + Intergenic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1029873640 7:103723521-103723543 CTGGTAGGATGGAAGGGAGATGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030364332 7:108628194-108628216 CTTGGAGGTTGGAAGCAAGATGG + Intergenic
1030621400 7:111795002-111795024 TTGAGGGGTGGAAAGGAAGAGGG + Intronic
1030660814 7:112217538-112217560 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1030680999 7:112433728-112433750 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1030685154 7:112478805-112478827 CTGGGCTTTTGGGAGGAAGAAGG + Intronic
1031595725 7:123647534-123647556 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1031883001 7:127217995-127218017 CTGGGGGGTTGGATGGTAAATGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032669682 7:134071759-134071781 CTTGGGGGTTAGAAGCAAGATGG + Intergenic
1033046736 7:137968884-137968906 CTAGGGGGTTGGAGAAAAGAAGG + Intronic
1033069629 7:138190441-138190463 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033232280 7:139609386-139609408 CTGGGAGGTGGGGAGGAAAAGGG + Intronic
1033340315 7:140486829-140486851 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1033365891 7:140672676-140672698 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033505463 7:141995283-141995305 CTGGGAGGTTAGAAGCAAGATGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035270704 7:157718457-157718479 CTGCAGGGTTGGGAGGAGGAAGG - Intronic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035435240 7:158854738-158854760 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1035451773 7:158981294-158981316 CTGGGGGGTTGGGAGGCTCAGGG + Intergenic
1035524091 8:298740-298762 CCGGTGGGAAGGAAGGAAGAGGG - Intergenic
1035811606 8:2496167-2496189 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1036048027 8:5165700-5165722 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036162177 8:6399435-6399457 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1036171972 8:6495995-6496017 CTTGGGGGTTGGGAGGGTGAGGG + Intronic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037018105 8:13933584-13933606 CTTGGAGGTTGAAAGCAAGATGG - Intergenic
1037200342 8:16244833-16244855 GTAAGGGGTTGGAAGGAAAAGGG - Intronic
1037735575 8:21563242-21563264 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037955300 8:23051978-23052000 CTTGTAGGTTAGAAGGAAGATGG + Intronic
1038070593 8:24008521-24008543 TAGGGAGGTTGGAAGGAAGTAGG - Intergenic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038328030 8:26587337-26587359 GCGGGGAGTTGGGAGGAAGAGGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038732186 8:30137651-30137673 CTTGGAGGTTAGAAGCAAGATGG - Exonic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1039013519 8:33122010-33122032 CTTGGAGGTTGGAAGCAAAATGG - Intergenic
1039184812 8:34905352-34905374 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1039301688 8:36216437-36216459 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1039620373 8:38991794-38991816 CAGGGTGGTTGGAAGATAGAAGG + Intronic
1039694439 8:39895528-39895550 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1039699282 8:39945853-39945875 CTTGGAGGTTAGAAGCAAGACGG - Intronic
1039959385 8:42234176-42234198 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1040354057 8:46598623-46598645 CTGGGGGTTTAGGAGGAAGAGGG + Intergenic
1040386288 8:46917016-46917038 CTGGGAGGTTAGAAGCAAGATGG - Intergenic
1040498541 8:47987905-47987927 CCTGGGGGTTAGAAGCAAGATGG + Intergenic
1040998024 8:53421428-53421450 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1041183473 8:55273302-55273324 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1041192301 8:55366155-55366177 GTGGGAGGTTGGAAGGTAGGAGG - Intronic
1041240645 8:55846245-55846267 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1041758062 8:61335390-61335412 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1041782208 8:61589577-61589599 CTGGTGGCTGGTAAGGAAGAGGG - Intronic
1041818905 8:62006429-62006451 CTGAAAGGTTGGAAGAAAGAGGG + Intergenic
1042508759 8:69589702-69589724 ATGGGGGGTGGGAAGGCACAAGG + Intronic
1042623166 8:70728155-70728177 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1043266923 8:78278457-78278479 CTTGGAGGTTAGAAGCAAGACGG - Intergenic
1043610311 8:82054727-82054749 CTTGGGAGTTGGAATGAAAAAGG + Intergenic
1044133847 8:88559922-88559944 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1044423787 8:92028080-92028102 GGGGGGGGTGGGAAGGAAGGAGG + Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045472822 8:102527606-102527628 CTTGGGGGTTAGAGGCAAGATGG - Intergenic
1045498374 8:102727091-102727113 CTGGGAGGTCGGGAGTAAGAGGG + Intergenic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1045991828 8:108316817-108316839 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047385012 8:124401009-124401031 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1047413344 8:124642433-124642455 GTGGGTGATTGGCAGGAAGATGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1049051199 8:140198139-140198161 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1049315555 8:141965151-141965173 CTGGAGGATTGGAAGGGAGCAGG - Intergenic
1049353827 8:142178038-142178060 CGGGGCTGTTGGAAGGACGAGGG - Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049469101 8:142767447-142767469 GTGGGGGGTAGCAGGGAAGATGG + Intronic
1049580518 8:143408610-143408632 CTAGGGGGTGGGAAGGCTGACGG - Intergenic
1050683771 9:8144395-8144417 CTTGGGGGTAGGCAGGTAGATGG - Intergenic
1050739313 9:8802132-8802154 ATGGGGGGATGGAAGGACCAGGG - Intronic
1050789411 9:9447510-9447532 TTGGAGGGTAGGAAGTAAGAGGG + Intronic
1050879875 9:10685911-10685933 TTGGAGGGTAGGAAGCAAGATGG + Intergenic
1051604590 9:18907370-18907392 CTGTGGGGTTGGGAGGGAGGGGG - Intronic
1051643720 9:19247881-19247903 CTGGTGGATTGGAAGTAAAAGGG - Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1052837368 9:33261798-33261820 CAGGGGGGTGGGAAGACAGAGGG + Intronic
1052987780 9:34500880-34500902 CTGGGGGTTTGGGATGTAGAGGG - Intronic
1053074741 9:35123256-35123278 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1053203543 9:36168343-36168365 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053495785 9:38547072-38547094 GTTTGGGGTTGGAAGGAAAAGGG - Intronic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055450410 9:76426222-76426244 CTTGGAGGTTAAAAGGAAGATGG + Intronic
1056409575 9:86312332-86312354 CTGGGCGGTTGCCAGGCAGAGGG - Intronic
1056518206 9:87374752-87374774 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1056571469 9:87820424-87820446 CTGGGAGGTGAGAAAGAAGAGGG + Intergenic
1056641564 9:88376107-88376129 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056901807 9:90606896-90606918 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1056956510 9:91086008-91086030 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1057235880 9:93359507-93359529 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057318468 9:93989248-93989270 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1057337517 9:94166883-94166905 CTTGGGGGTTGGGATGAAGGAGG + Intergenic
1057366430 9:94425868-94425890 CTTGGAGGTTAGAAGTAAGATGG + Intronic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057467412 9:95328054-95328076 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1057629784 9:96710308-96710330 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1057656903 9:96962197-96962219 CTTGGAGGTTAGAAGTAAGATGG - Intronic
1057746511 9:97756494-97756516 CTAGGGGTTTGGGAGGAAGTGGG - Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057830936 9:98406463-98406485 CTGGGGTGCTGGAAAGATGACGG + Intronic
1057980509 9:99657484-99657506 CTTTGGGGTTGGGATGAAGAAGG - Intergenic
1058384042 9:104411864-104411886 CTTGGAGGTTAGAAGCAAGAAGG + Intergenic
1058829545 9:108803185-108803207 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1058995536 9:110295110-110295132 CTCGGAGGTTAGAAGCAAGATGG + Intergenic
1059022595 9:110592682-110592704 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059137137 9:111817886-111817908 CTTGGAGGTTAGAAGCAAGACGG + Intergenic
1059161958 9:112042995-112043017 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1059714328 9:116899566-116899588 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1059938944 9:119338924-119338946 CAGGGGGGTGGGGAGAAAGAAGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060615072 9:125005733-125005755 CTGGTTGGTTGGTTGGAAGATGG + Intronic
1060662715 9:125413915-125413937 CTGGAGGGTTTTAAGCAAGATGG + Intergenic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061081582 9:128374032-128374054 TTGGGGGGGTTGAAGGAAGATGG + Intronic
1061089323 9:128418076-128418098 CTGGGGGGTTGGGAGGTCCAAGG + Intronic
1061295928 9:129676708-129676730 CTGCGGGCTTGGAAGCCAGAGGG + Intronic
1061306189 9:129734603-129734625 GGGGGGAGTTGGGAGGAAGATGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061555574 9:131366343-131366365 CTTGGGGGTTAGAAGCAAGATGG + Intergenic
1061635492 9:131905849-131905871 CTGGGTAGATGGGAGGAAGAAGG - Intronic
1062130567 9:134890684-134890706 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062365686 9:136207962-136207984 CCTGGGGGTTGGAAGGATGGGGG - Exonic
1062695497 9:137873743-137873765 CTGGAGGGTCCGGAGGAAGATGG + Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1185960091 X:4539640-4539662 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1185973027 X:4685758-4685780 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1186116739 X:6311703-6311725 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1186278978 X:7972420-7972442 CTTGGAGTTTGGAAGCAAGATGG - Intergenic
1186711311 X:12200301-12200323 TTTGGAGGTTGGAAGCAAGATGG + Intronic
1186833153 X:13411352-13411374 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1187074300 X:15918511-15918533 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1187122756 X:16425208-16425230 TTGGGTGGTTGGAGGGAAGGAGG - Intergenic
1187136339 X:16551157-16551179 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1187157147 X:16731427-16731449 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1187240149 X:17505434-17505456 GTTGCAGGTTGGAAGGAAGAAGG - Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1187816437 X:23237350-23237372 CTGGGAGGTTAAAAGCAAGATGG + Intergenic
1187910850 X:24110063-24110085 TTGGGAGGTTGGGAGGATGAGGG - Intergenic
1188159511 X:26783161-26783183 CTTGGGGGCTGGAAGCAAGATGG - Intergenic
1188179737 X:27040018-27040040 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1188686620 X:33077338-33077360 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1188911623 X:35854816-35854838 CTGGGATGTTGGAAGCAAAATGG + Intergenic
1188939308 X:36217097-36217119 CTTGGAGGTTAGAAGAAAGATGG + Intergenic
1188999786 X:36931498-36931520 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1189116290 X:38345999-38346021 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1189416764 X:40822177-40822199 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1189550601 X:42088697-42088719 CTCGGAGGTTAGAAGCAAGATGG - Intergenic
1189758865 X:44300541-44300563 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1189777574 X:44484086-44484108 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1189784721 X:44549227-44549249 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1189953967 X:46259623-46259645 CTTGGAGGTTAGAAGTAAGATGG + Intergenic
1189967399 X:46389103-46389125 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1190083675 X:47376780-47376802 CTCGGAGGTTTGAAGAAAGATGG - Intronic
1190087392 X:47407873-47407895 GTGGGGTGTTGGAAGGTAGGAGG - Intronic
1190154246 X:47974947-47974969 CTGGGGGGATGGAATTGAGAGGG - Exonic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1190956272 X:55197424-55197446 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191224745 X:58031314-58031336 GTGGGGGCTTCCAAGGAAGAGGG + Intergenic
1191792417 X:64984871-64984893 CTTGGAGGTTAGAAGCAAGATGG + Intronic
1192117306 X:68423577-68423599 CTGGGGGGTTGGAATGTATTGGG - Intronic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192338669 X:70243401-70243423 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1192783969 X:74320261-74320283 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1192804643 X:74498005-74498027 CTTGGAGGTTAGAAGCAAGATGG - Intronic
1192812271 X:74557950-74557972 CTTGGCGGTTAGAAGTAAGATGG - Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193686667 X:84584885-84584907 ATGGGAGGTAGGAAGGAAGAAGG + Intergenic
1193767046 X:85542718-85542740 CTTGGAGGTTAGAAGCAAGACGG - Intergenic
1194045115 X:88992652-88992674 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1194411479 X:93563807-93563829 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1194451329 X:94047739-94047761 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1194475983 X:94360593-94360615 CTTGGAGGTTAGAAGAAAGATGG - Intergenic
1194518857 X:94893652-94893674 ATTGGTGGCTGGAAGGAAGAAGG - Intergenic
1194629194 X:96262791-96262813 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1194808734 X:98364105-98364127 CTTGGATGTTGGAAGCAAGATGG - Intergenic
1194905625 X:99573402-99573424 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1194932547 X:99904903-99904925 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1194960007 X:100224261-100224283 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1195048428 X:101076032-101076054 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1195101890 X:101562884-101562906 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1195244303 X:102981651-102981673 CTGGTGGGTTGGGAGAAGGAAGG + Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196716325 X:118814702-118814724 GTTGGGGGTAGGAAGGAAAAGGG - Intergenic
1196768111 X:119268074-119268096 CTGGGGGGTAGCAGCGAAGATGG - Intergenic
1196778515 X:119362068-119362090 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1197209657 X:123818343-123818365 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197481150 X:126987850-126987872 CTTGGAGGTTAGAAGCAAGATGG + Intergenic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198686015 X:139228880-139228902 ATAGGGGGATGGAATGAAGATGG + Intergenic
1199305719 X:146265349-146265371 CTGGGGGCTTGCCAGGCAGAGGG - Intergenic
1199355930 X:146864300-146864322 CTTGGAGGTTAGAAGCAAGATGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200097909 X:153672715-153672737 GTGGGAGGTGGGAAGGAAGTGGG + Intronic
1201642301 Y:16192615-16192637 CTTGGAGGTTGAAAGCAAGATGG - Intergenic
1201660513 Y:16392705-16392727 CTTGGAGGTTGAAAGCAAGATGG + Intergenic
1201749012 Y:17412447-17412469 CTTAGGGGTTAGAAGCAAGATGG - Intergenic
1201917949 Y:19203087-19203109 TTGGGGAGTGGGAAGGCAGAAGG - Intergenic