ID: 979347718

View in Genome Browser
Species Human (GRCh38)
Location 4:119608247-119608269
Sequence CTGCAGTCCAAGAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979347718 Original CRISPR CTGCAGTCCAAGAAAACTGA AGG Intronic
900434460 1:2622153-2622175 CTGTAGCCCAGGCAAACTGAGGG + Intronic
905596208 1:39209761-39209783 CTGAAGTTCAAGAAAACCAAGGG - Intronic
907151688 1:52294696-52294718 CTCTGGTCCAAGAAAACTGAAGG - Intronic
910175552 1:84426703-84426725 CTGCAGACCTAGCAAACTGGTGG - Intergenic
910599321 1:89013645-89013667 CTGCAGCCTAAGACAAATGATGG - Intronic
911050009 1:93663004-93663026 CCAAAGTCCAAGAAGACTGAGGG - Intronic
911143712 1:94532725-94532747 CTGCAGTAAAAGAAAAAGGAAGG + Intronic
913667380 1:121060740-121060762 CGGCAGTCCAAGAAAAGGGGAGG - Intergenic
914019071 1:143847883-143847905 CGGCAGTCCAAGAAAAGGGGAGG - Intergenic
914657622 1:149756090-149756112 CGGCAGTCCAAGAAAAGGGGAGG - Intergenic
917641786 1:176990011-176990033 AGGCAGTCCAAGAAAGCTGAAGG - Intronic
919108778 1:193190580-193190602 CTGCTGCACAAGAAAACTGAAGG - Intronic
923481836 1:234392503-234392525 CTGCAGCAGAAGAAAACAGAAGG - Exonic
924515831 1:244765272-244765294 CTGTAGTCCCAGATAATTGAGGG - Intergenic
1063372553 10:5531318-5531340 CTGCAGTCCCAGAAAACAAGAGG + Intergenic
1063613654 10:7584208-7584230 ATGCAGTTCAAGAAAAATAAAGG + Intronic
1065699093 10:28407414-28407436 CAGAAGTCCAAGAAAAATGATGG - Intergenic
1066285873 10:33965657-33965679 CTCCATGCCAAGAAAACAGATGG + Intergenic
1066655078 10:37690673-37690695 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067040129 10:42946764-42946786 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067344750 10:45429087-45429109 CTGGAGACCAAGACCACTGAGGG + Intronic
1069274180 10:66568630-66568652 CTGCAGTCCAAGAAGGGTAAGGG + Intronic
1071904767 10:90160707-90160729 CTTCAGTTCAGGAAACCTGAAGG - Intergenic
1074156637 10:110805739-110805761 ATGCAGTCCTAGAAAAGTGCTGG - Intronic
1075212775 10:120505152-120505174 CTGCATTCCAAGAGAGATGAGGG + Intronic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1075556863 10:123439200-123439222 CTGTAGACAAAGAGAACTGAAGG + Intergenic
1088368893 11:109067268-109067290 TTGCAGGCCAAGAATACTGGGGG + Intergenic
1088619634 11:111668836-111668858 ATGCAGTTCAAGAAAAATGGTGG + Intronic
1090337274 11:125979742-125979764 CCATTGTCCAAGAAAACTGAAGG - Intronic
1091541507 12:1466597-1466619 CTGCATTCCAAATAAACTGTGGG + Intronic
1091834958 12:3579256-3579278 CTGGGGTCCAAGAATATTGAAGG - Intronic
1092525296 12:9306102-9306124 CTGCAGCCCAGGACGACTGAAGG + Intergenic
1092541976 12:9425715-9425737 CTGCAGCCCAGGACGACTGAAGG - Intergenic
1093267911 12:17024625-17024647 CTGTAGTCCAGGAATAGTGAGGG + Intergenic
1094511034 12:31096724-31096746 CTGCAGCCCAGGACGACTGAAGG + Exonic
1096023428 12:48340988-48341010 CTGCATTCCAGGAAGAATGAAGG + Exonic
1098424292 12:70341885-70341907 CTGTATTGCAAGAATACTGAGGG + Intronic
1100267073 12:92987833-92987855 CTGCAATCCAAGCACTCTGAGGG - Intergenic
1102215187 12:111156236-111156258 CTGCTTCCCAAGAAACCTGATGG + Intronic
1105367219 13:19776341-19776363 CTGCGGTCCCAGCAACCTGAGGG + Intronic
1106829299 13:33561917-33561939 TTTCAGGCTAAGAAAACTGAAGG - Intergenic
1107063028 13:36181835-36181857 CTGCAGAGTAAGAAAGCTGAAGG - Intronic
1110033699 13:70652910-70652932 CTGCAGTACAAGAAGCCTAAAGG - Intergenic
1110688684 13:78405513-78405535 CTGAAGTCCTGGAAAACTGAAGG + Intergenic
1110742499 13:79014409-79014431 CTGTAGTCCAAGAATACGGTTGG + Intergenic
1111230461 13:85339744-85339766 CTGTGCTCCAAGAAAACTAATGG + Intergenic
1111302147 13:86361197-86361219 CTGTAGTCCAGGAAAAGTCAGGG - Intergenic
1115391405 14:32858407-32858429 CTACACTCAAGGAAAACTGAGGG + Intergenic
1116508257 14:45712560-45712582 CAAAAGTCCAAGAAAATTGAGGG - Intergenic
1116923528 14:50608220-50608242 CTGCAGTGTAGAAAAACTGATGG + Intronic
1117460846 14:55943143-55943165 CAGCAGACCCACAAAACTGAGGG - Intergenic
1117554936 14:56874493-56874515 CTGCAGTCCAAGCCAACACACGG + Intergenic
1118206746 14:63729624-63729646 CTGTAGTCCCAGATAACTGGGGG + Intergenic
1120252429 14:82074917-82074939 ATGCAGTCCAAGAAAATTCATGG - Intergenic
1120453723 14:84704047-84704069 CCGAAGTCCAAGGAAACTGAGGG - Intergenic
1121555915 14:94836958-94836980 CTGCAGGAGAAGAAAATTGATGG - Intergenic
1122526355 14:102387929-102387951 CTGTATTCCAAGAAAACGGAAGG + Intronic
1125403895 15:39333077-39333099 TTACAGTCCAAGGAGACTGAAGG + Intergenic
1128377304 15:67086377-67086399 CTACAGCCTAAGAAATCTGATGG + Intronic
1130989483 15:88867615-88867637 CTGCAGCCCAAGAACTCTGATGG + Intronic
1137994620 16:53196876-53196898 CTTCAACTCAAGAAAACTGAAGG - Intronic
1141778702 16:86142374-86142396 CTGCAGCCCAAGAACACCAAGGG + Intergenic
1142338247 16:89504280-89504302 CTGCAGTCCAAGAGCTCTGGAGG + Intronic
1148563336 17:48618791-48618813 CTGCTCTCCCAGAAAACTGGTGG - Intronic
1148655311 17:49278834-49278856 CTGCAGTCCCAGAGAATTCAGGG + Intergenic
1149635760 17:58168032-58168054 CTGGAGTGGAAGTAAACTGAAGG + Intergenic
1150073122 17:62169369-62169391 CTGCAGTCCAGGAATGATGAGGG + Intergenic
1151409633 17:73913389-73913411 CTGTAGTCCAAAAAACCTCAAGG + Intergenic
1151922090 17:77164506-77164528 CTCCTGTCCAAGCAAACAGAAGG - Intronic
1153503144 18:5769104-5769126 TTGCAGTCCTAAGAAACTGATGG - Intergenic
1153534901 18:6090984-6091006 CTGCTGTCCAAAAATAGTGATGG - Intronic
1154931518 18:21001879-21001901 ATGCAATCTTAGAAAACTGATGG + Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1156882670 18:42099609-42099631 CTGCATTCCATGGAAAATGATGG - Intergenic
1158004514 18:52656919-52656941 ATGCTGTCCAAGAGATCTGAAGG - Intronic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1161841586 19:6684818-6684840 CTGCAGACCAAGGAAAATGAGGG - Exonic
1163054202 19:14706133-14706155 CTGGAGTCCAGGAGAACTAACGG - Intronic
1165256728 19:34580774-34580796 CTGCAGTTCAAGAAAGGTCATGG + Intergenic
1166050012 19:40253242-40253264 ATGCCGTCCAAGAAAACTTCCGG - Intronic
925244066 2:2363958-2363980 CTGCACTCCAAGAAGAAAGAGGG - Intergenic
926311691 2:11680103-11680125 CAGCAGTCCAGGAATGCTGAGGG + Intronic
926922370 2:17951770-17951792 CTCCAATCCAAGAGAGCTGAAGG - Intronic
927186928 2:20488552-20488574 CTGGAGTCCAAGGGACCTGAAGG + Intergenic
928779614 2:34803883-34803905 CTGTAGTCCAGGAATAGTGAGGG + Intergenic
932047377 2:68363315-68363337 TTGCAGTGAAAGAACACTGACGG + Intergenic
933179673 2:79214734-79214756 CTGTAGTCCAAGAATAGTCAGGG + Intronic
933557409 2:83848381-83848403 CTCAAGTTAAAGAAAACTGAAGG - Intergenic
936745807 2:115575026-115575048 GTGCTGTACAATAAAACTGAAGG - Intronic
937266582 2:120619649-120619671 CTGCAGCTCATGACAACTGATGG + Intergenic
938250273 2:129809828-129809850 CTGCATTACAAGAAATGTGAAGG - Intergenic
939970587 2:148654734-148654756 CTGCTGTGCCAGAAAACAGAAGG - Intronic
941234463 2:162952806-162952828 ATGGAGACCAAGAAATCTGATGG - Intergenic
943469624 2:188277406-188277428 CTGAAATAGAAGAAAACTGAGGG + Intergenic
944216739 2:197263724-197263746 CAGCAGTACAGGAACACTGAAGG + Intronic
944656441 2:201880787-201880809 CCACAGTCCAAGAAACATGACGG - Intronic
945354627 2:208824948-208824970 CTACACTAAAAGAAAACTGATGG - Intronic
946405003 2:219487675-219487697 CTGCAGTCTAGGAAAACTGTGGG - Intronic
1169423735 20:5480256-5480278 CTGTAGTCCTAGCAACCTGAGGG + Intergenic
1170258774 20:14378451-14378473 CTTCAGTTCAGGATAACTGAGGG + Intronic
1172409558 20:34711166-34711188 CTGCAGGCCCTGAAATCTGAAGG + Exonic
1173383960 20:42571695-42571717 CTGCTATCCAAGAAGGCTGAGGG + Intronic
1175297119 20:57916105-57916127 CTGCAGTCCTAGAGAATGGAGGG - Intergenic
1176056019 20:63149668-63149690 CTGCAGACCCAGAAACCTCAGGG - Intergenic
1176873134 21:14099963-14099985 CTGCAAGTCATGAAAACTGATGG + Intergenic
1178399440 21:32272398-32272420 GTGAAGTCCAAGACAACTGAAGG + Intronic
1181083264 22:20427649-20427671 CTGCAGTCCAAGAATAGGGCTGG - Intronic
1182651855 22:31858235-31858257 CAGCAGTCTGAGAAAACTGATGG - Intronic
1183336994 22:37255071-37255093 CTGCAGACAAAGAATACAGACGG + Intergenic
1184180096 22:42815747-42815769 TAGCAGTTCATGAAAACTGAAGG - Intronic
1184909281 22:47515711-47515733 CTGGAGTCCAAGATGACTGTGGG + Intergenic
950825398 3:15813694-15813716 CTGCAGTCCAACACACCTGGAGG + Intronic
951958037 3:28279236-28279258 CTTCAGACCAACAAGACTGAGGG - Intronic
952335676 3:32401447-32401469 CTGCAGTGCCAGAAAACCTATGG - Intronic
952790126 3:37193764-37193786 CTGTAGTCCTAGAAACCTGGGGG - Intergenic
953841079 3:46390688-46390710 CTGCAGCCCAGGAATACTCAGGG + Intergenic
953895758 3:46798886-46798908 CTGGAGAACAGGAAAACTGATGG - Intronic
954448384 3:50558761-50558783 CTGCAGTCCCTGAAGATTGAAGG + Exonic
955105672 3:55895542-55895564 GTGCAGGCAATGAAAACTGAAGG - Intronic
955289228 3:57675491-57675513 CTGCAGTTTAAGAAACCTCAAGG + Intronic
955625300 3:60912206-60912228 CTGCAGTACATGTAATCTGAAGG + Intronic
956395262 3:68819147-68819169 CTGCAGTCCCAGCTATCTGAAGG + Intronic
956626678 3:71273542-71273564 CTGCATTCAAGGAAGACTGAAGG - Intronic
957295334 3:78326598-78326620 CTGTAGTCCAGGAATACTCAGGG - Intergenic
958182979 3:90083856-90083878 CTGCAGTCCAGGAATAGTGAGGG - Intergenic
960002163 3:112744159-112744181 TTGCAGTTGAAGAAAACAGAGGG + Intronic
960215395 3:115029319-115029341 CAGAAGTCCAATAAAATTGAAGG + Intronic
960670764 3:120153657-120153679 CTTTTGTCCAAGAAAACTCAGGG - Intergenic
961331495 3:126144233-126144255 CTCCAGTCCATGAACACAGATGG - Intronic
963101421 3:141609491-141609513 CTGCAGCTTAAGTAAACTGAGGG - Exonic
963520532 3:146356343-146356365 CTGTAGTCCAGGAATACTCAGGG - Intergenic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
966260010 3:177965403-177965425 CTGTAGTCTATGAATACTGATGG - Intergenic
966937047 3:184717395-184717417 CTGTAATCCAAGCAAACTGGCGG - Intergenic
969903826 4:10374430-10374452 ATGCTGCCCGAGAAAACTGAGGG + Intergenic
970683143 4:18534656-18534678 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
973604265 4:52571014-52571036 CAGCAGGCCAAGAAACCAGAAGG - Intergenic
976402915 4:84627699-84627721 TTTGAGTCCAAGAAAATTGATGG + Intronic
976770764 4:88649922-88649944 CTGCACCCCAAGAAAACAGCTGG - Exonic
978074227 4:104509048-104509070 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
978508782 4:109492749-109492771 CTGCACTCCAATAAACATGAAGG - Intronic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979347718 4:119608247-119608269 CTGCAGTCCAAGAAAACTGAAGG + Intronic
981006768 4:139883132-139883154 CAGCAGACCAAGAAAACTGCAGG + Intronic
982135874 4:152273520-152273542 CAGCAGTCCAAGAAGTCTGTGGG + Intergenic
982199506 4:152946604-152946626 CTGCAGTCCACACAAACAGATGG - Intronic
982402717 4:154985846-154985868 CTGCATACCAAGAAAACTGATGG - Intergenic
984207714 4:176806116-176806138 ATGCAGTTCAAGCAAACTGCAGG - Intergenic
985655143 5:1127570-1127592 CAGCAGTCCGAGGAAACTGATGG + Intergenic
986544174 5:8877307-8877329 CTGCAGACTAAGAAAACTTTGGG - Intergenic
990690179 5:58354977-58354999 ATGAAGTCCCAGAAAATTGATGG - Intergenic
992010436 5:72520588-72520610 CTGCAAGCCAGGAAAACTGTGGG + Intergenic
996523977 5:124457790-124457812 CTGGACTGCAAGAAACCTGAAGG + Intergenic
997866485 5:137468221-137468243 CTGCAGTTAAAGAGAACAGAGGG + Intronic
998989098 5:147795317-147795339 CTGCAGTTCCCCAAAACTGAGGG - Intergenic
999248857 5:150169681-150169703 CTGCTGTCCAGGACAGCTGAAGG + Intronic
999553970 5:152720907-152720929 CTACAGACCCAGAAAACTCAGGG + Intergenic
1000282489 5:159794116-159794138 CTGCAGGTGAAAAAAACTGAGGG + Intergenic
1001331357 5:170764964-170764986 CTGCAGTCCAGGAATAGTCAGGG + Intronic
1001354211 5:171004311-171004333 CTGCAGTCCAGGAATAATCAGGG + Intronic
1001623002 5:173104807-173104829 ATTAAGTCAAAGAAAACTGATGG + Intronic
1002281041 5:178130439-178130461 CTGCTGTCCAGGGAAAATGATGG - Intergenic
1002281319 5:178131481-178131503 CTGCTGTCCAGGGAAAATGATGG + Intronic
1002321994 5:178381842-178381864 CAGCAGTTCAAGAACAGTGAGGG - Intronic
1002416698 5:179124509-179124531 CTGGAATCCCAGGAAACTGAGGG - Intronic
1002889728 6:1322009-1322031 CTGCAGTTCACCAAAAATGAAGG - Intergenic
1003274863 6:4641019-4641041 GTGCAGTCCAAGAAGATTTATGG + Intergenic
1004449969 6:15736338-15736360 CTGCAGTGCCTGAAAACTGCAGG - Intergenic
1004883211 6:20028508-20028530 CTGTAGTCCAGGAGAAATGATGG - Intergenic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1005514959 6:26545438-26545460 CTCCAGTCCCAGAAAGCGGAAGG + Exonic
1006024956 6:31140787-31140809 CTGCAGTCCAAGTACGCTGATGG + Intergenic
1007868375 6:45002255-45002277 CTGTAGACCTAGAAAACTGGGGG - Intronic
1008395837 6:51005361-51005383 GAGCAGTCCAAGACAACTGCAGG + Intergenic
1009158390 6:60251020-60251042 TTGCAGTCCAGGAACAATGAGGG - Intergenic
1010097505 6:72063799-72063821 CAGCAGCCCTAGCAAACTGATGG - Intronic
1011219428 6:85038179-85038201 CTCCAGTTCCAGAAAGCTGAGGG - Intergenic
1013719841 6:113011457-113011479 CTGCCATCAGAGAAAACTGAAGG - Intergenic
1013965981 6:115955884-115955906 CTGTAGTCAGAGAAGACTGAAGG - Intronic
1014219258 6:118783716-118783738 CTGAAGTCCAAGGCAACTGTTGG - Intergenic
1014791364 6:125676092-125676114 CAGCCATCCAAGAAAACTGTGGG + Intergenic
1017961137 6:159221624-159221646 CTGCAGTCCATGAACTCTCAGGG + Exonic
1019867990 7:3730893-3730915 CTGTATTCCAAAAAGACTGATGG - Intronic
1022225448 7:28358126-28358148 CTGAAGTCCAAAAGAAATGAAGG + Intronic
1023987840 7:45107667-45107689 CTGCTGTCCATGAAACCGGAAGG - Intronic
1024104826 7:46072292-46072314 CTCAAGTCCATGAAAATTGAGGG + Intergenic
1025259813 7:57411334-57411356 ATGCATTCCAAGAAGACTGAAGG + Intergenic
1026612801 7:71875382-71875404 CTGCAGTCCAGGAAAGCCGTGGG + Intronic
1026975273 7:74494033-74494055 ATGCAGTCCAAGATAAATAACGG - Intronic
1027444435 7:78256263-78256285 CTGCACTCCATGCCAACTGATGG - Exonic
1028579370 7:92389728-92389750 CAGCAGCCCAGGAACACTGATGG - Intronic
1029602645 7:101577950-101577972 CTGCATTCCAATAAAACTTTAGG - Intergenic
1030524146 7:110633465-110633487 CAGCTGTCCAAGAAACGTGATGG - Intergenic
1034241877 7:149617172-149617194 CTGCAGGCACAGAACACTGATGG + Intergenic
1035194751 7:157207597-157207619 CTACTGTCTATGAAAACTGATGG - Intronic
1035246903 7:157568519-157568541 CTGCACTGCAACAACACTGAAGG + Intronic
1036179373 8:6569867-6569889 CTCCAGCTCAAGAGAACTGAAGG - Intronic
1036501248 8:9316368-9316390 CTGAAGTCCCAGAAATCTAAAGG + Intergenic
1037272753 8:17147357-17147379 CTGCAGCCCAAGATGAATGATGG - Intergenic
1038528570 8:28297744-28297766 CTCCATTCCAAGTGAACTGAAGG - Intergenic
1041954278 8:63540256-63540278 CTGGAGAACCAGAAAACTGATGG + Intergenic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1043005370 8:74811659-74811681 CTGGTGTCCAAGAACCCTGAGGG - Intronic
1043026159 8:75072075-75072097 TTACAGTCCAACAACACTGAAGG + Intergenic
1043208205 8:77474793-77474815 TTGCAGTCCTAGAAAATTGCGGG + Intergenic
1043293680 8:78637311-78637333 CTGTAGTCTAAAAAAAATGATGG - Intergenic
1043450772 8:80363946-80363968 CTGAAATGGAAGAAAACTGAGGG + Intergenic
1043598933 8:81916222-81916244 CTGTAGTCCAGGAATACTCATGG - Intergenic
1047361000 8:124169345-124169367 GTGCAGTCCAAGAAACCAGACGG - Intergenic
1049135900 8:140899309-140899331 CTGAGTTCCAAGAAAACCGAGGG - Intronic
1051667556 9:19479859-19479881 CTGCAGATAAAGAAGACTGAAGG - Intergenic
1051932763 9:22406511-22406533 CTACACTCCCAGAAAACTGAGGG + Intergenic
1053304768 9:36976608-36976630 CTGCAGACTAAGAAAAATCAAGG + Intronic
1057456652 9:95219165-95219187 CTGTAGTGCATGAAAACTGCAGG + Intronic
1058177765 9:101757524-101757546 TTGAAGTCCAAGAAAATAGATGG - Intergenic
1059262860 9:112995293-112995315 CTGAAGGGCAGGAAAACTGAAGG - Intergenic
1059535161 9:115073825-115073847 CTGCAGTTTCAGAAACCTGAAGG + Exonic
1059599089 9:115756484-115756506 ATTCTGTCTAAGAAAACTGAGGG + Intergenic
1059992903 9:119882010-119882032 CTGCAGGCCAGGAAACCTAAGGG + Intergenic
1060458594 9:123825932-123825954 CAGCAGAAAAAGAAAACTGATGG - Intronic
1061517496 9:131098136-131098158 AAGCAGTCCAAGAAAACCAAGGG - Intronic
1061948154 9:133920318-133920340 CAGCAGTGCAAGACAGCTGAGGG + Intronic
1188200869 X:27292061-27292083 CTGTAGTCCAAGAATAGTCAGGG + Intergenic
1190382695 X:49855012-49855034 ATGAAGTCCAATAAAACAGATGG - Intergenic
1190641604 X:52485723-52485745 ATGCATCCCAAGAAGACTGAAGG - Intergenic
1190646068 X:52527142-52527164 ATGCATCCCAAGAAGACTGAAGG + Intergenic
1194606593 X:95986674-95986696 GAGAAGTCCAAGAAAATTGAGGG - Intergenic
1196943559 X:120801583-120801605 CTCCAGTCCAAGAAAACCTGGGG + Intergenic
1198293086 X:135257491-135257513 CTGCAGTCGAACAAAACAAAAGG + Intronic
1198614723 X:138444345-138444367 CTGCATTCCCAGCAAAATGAAGG + Intergenic
1202133638 Y:21637672-21637694 TTGCAGCCCAAGACACCTGAGGG + Intergenic