ID: 979349664

View in Genome Browser
Species Human (GRCh38)
Location 4:119628962-119628984
Sequence TTCCCAGGAGGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 1, 2: 23, 3: 125, 4: 1039}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979349651_979349664 24 Left 979349651 4:119628915-119628937 CCGGGGTCCGGCAGTGTTCCGCT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349650_979349664 25 Left 979349650 4:119628914-119628936 CCCGGGGTCCGGCAGTGTTCCGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349648_979349664 29 Left 979349648 4:119628910-119628932 CCCACCCGGGGTCCGGCAGTGTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349654_979349664 6 Left 979349654 4:119628933-119628955 CCGCTCTCGCAGGCTCTTCAGTC 0: 1
1: 0
2: 1
3: 14
4: 141
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349652_979349664 17 Left 979349652 4:119628922-119628944 CCGGCAGTGTTCCGCTCTCGCAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349649_979349664 28 Left 979349649 4:119628911-119628933 CCACCCGGGGTCCGGCAGTGTTC 0: 1
1: 0
2: 1
3: 18
4: 267
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039
979349647_979349664 30 Left 979349647 4:119628909-119628931 CCCCACCCGGGGTCCGGCAGTGT 0: 1
1: 0
2: 1
3: 6
4: 84
Right 979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG 0: 1
1: 1
2: 23
3: 125
4: 1039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979349664 Original CRISPR TTCCCAGGAGGCGGCGGCGG CGG Exonic
900313302 1:2044989-2045011 TGCCCAGGAGGGGGCGCAGGAGG - Intergenic
900512974 1:3069051-3069073 CGCCGAGGCGGCGGCGGCGGCGG + Intergenic
901086706 1:6615115-6615137 TTCCGAGGAGGCGGCCGGGGGGG + Intronic
901116866 1:6852835-6852857 TTCCCAGGAGGTGGTGGGGTGGG + Intronic
901219227 1:7573595-7573617 TTGCCAGGAGCCAGCGGAGGCGG - Intronic
901446844 1:9313711-9313733 TTCCCAGGAAGCTGCAGCAGGGG + Intronic
901459473 1:9383140-9383162 TTCCCGGGAGGCGGGGACTGTGG - Intergenic
902350110 1:15847965-15847987 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
902690586 1:18108104-18108126 TGCCCGGGAGCTGGCGGCGGTGG - Exonic
902823242 1:18956238-18956260 TGCCCTGGCGGGGGCGGCGGCGG - Exonic
902896892 1:19485433-19485455 TACCATGGTGGCGGCGGCGGCGG + Exonic
902940940 1:19799851-19799873 TTACCTGGAGGCGGCTGCGAAGG + Exonic
903498901 1:23791252-23791274 TACCCAGCCGGCGGCTGCGGAGG + Intronic
903514805 1:23903074-23903096 TTCATGGGCGGCGGCGGCGGCGG + Intronic
903652327 1:24929789-24929811 TTCCCCTGCGGCGGCGGCGGCGG - Exonic
903805194 1:26000188-26000210 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
903829118 1:26164412-26164434 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
903875861 1:26472673-26472695 CACCAGGGAGGCGGCGGCGGCGG - Intronic
903886886 1:26545956-26545978 TTCCCAGGAAGCAGCGGCCCAGG + Exonic
903967580 1:27100129-27100151 TTCCCGGGAGGCGGCAGGGGAGG + Exonic
903991257 1:27271713-27271735 AACCCAGGAGGCGGAGGCTGTGG - Intronic
904039296 1:27575177-27575199 AGCCCCAGAGGCGGCGGCGGCGG - Intronic
904216556 1:28925073-28925095 TACTCAGGAGGCTGAGGCGGGGG - Intronic
904289931 1:29478440-29478462 TCACAAGGAGGCGGGGGCGGCGG + Intergenic
904483437 1:30808071-30808093 TTCTCAGGAGGTGGGGGAGGGGG + Intergenic
904618940 1:31764115-31764137 CGGCAAGGAGGCGGCGGCGGCGG - Intronic
904676180 1:32200639-32200661 TTCCCGGGAGGAGAGGGCGGAGG + Exonic
904697480 1:32338288-32338310 ATCCCAGGAGGCTGGGGAGGGGG + Intergenic
904715881 1:32467327-32467349 AACCCAGGAGGCGGTGGAGGCGG - Intronic
904762700 1:32817303-32817325 TTCCCGGCACGCGGCGGCGACGG - Exonic
904766440 1:32852201-32852223 TACCCAGGAGGCTGAGGCAGGGG + Intronic
904822727 1:33256161-33256183 TTGCCAGGCGGTGGCGGCGGCGG + Intergenic
904822830 1:33256457-33256479 CGCCGAGGCGGCGGCGGCGGCGG - Intergenic
905137120 1:35808335-35808357 TTACGCGGCGGCGGCGGCGGCGG + Exonic
905258847 1:36703564-36703586 TTCCCAGGAGGCTGGAGCAGTGG - Intergenic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
905783295 1:40731592-40731614 TACTCAGGAGGCTGAGGCGGGGG - Intronic
905947772 1:41918117-41918139 ATCACAGGCGGCGGCGGCGGCGG - Intronic
906397991 1:45483670-45483692 TTGCCGCGAGGGGGCGGCGGAGG + Intronic
906960918 1:50419097-50419119 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
907184451 1:52599271-52599293 AACCCAGGAGGCGGCGGTTGCGG - Intergenic
907218869 1:52890342-52890364 TACCCAGGAGGCTGAGGCAGGGG - Intronic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
907426514 1:54382905-54382927 AACCCAGGAGGCGGAGGCTGCGG + Intronic
908244311 1:62215672-62215694 CTGCCAGGAGGCGGAGGCTGTGG - Intergenic
908854246 1:68406445-68406467 TCCTCAGGAGGCTGAGGCGGAGG + Intergenic
909078554 1:71081868-71081890 TTCCCAGGACGAGGCGGCTCTGG - Intergenic
910232069 1:84997367-84997389 GTCCCAAAAGGGGGCGGCGGTGG + Intergenic
910448993 1:87328532-87328554 CTCGGAGGCGGCGGCGGCGGCGG - Exonic
910916958 1:92299289-92299311 TTCCCAGGAGGTGCGGACGGCGG - Intronic
911590690 1:99744706-99744728 AACCCAGGAGGCGGAGGCTGCGG + Intronic
911953717 1:104209837-104209859 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
912380128 1:109242984-109243006 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
912514812 1:110210908-110210930 TCAACACGAGGCGGCGGCGGCGG - Intergenic
913565563 1:120069430-120069452 TGCCCAGGCGGCGGCGGCGGCGG - Exonic
913615718 1:120558169-120558191 TCCCGAGGCGGCGGCGGCGGCGG + Intergenic
913632567 1:120724123-120724145 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
913661551 1:121009925-121009947 TTGCCAGGAGGAGGCGGGAGCGG + Intergenic
914012922 1:143793105-143793127 TTGCCAGGAGGAGGCGGGAGCGG + Intergenic
914164905 1:145168080-145168102 TTGCCAGGAGGAGGCGGGAGCGG - Intergenic
914286161 1:146228805-146228827 TGCCCAGGCGGCCGCGGCGGCGG - Exonic
914339754 1:146749819-146749841 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
914547188 1:148679549-148679571 TGCCCAGGCGGCGGCGGCGGAGG - Intronic
914574558 1:148952733-148952755 TCCCGAGGCGGCGGCGGCGGCGG - Intronic
914619315 1:149390797-149390819 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
914651547 1:149701714-149701736 TTGCCAGGAGGAGGCGGGAGCGG + Intergenic
914727402 1:150339512-150339534 AACCCAGGAGGCGGAGGCTGTGG - Intronic
914730393 1:150364665-150364687 TCCTCTGGCGGCGGCGGCGGCGG - Intronic
914741971 1:150472759-150472781 TCCCCAGGAGGGGGAGGAGGAGG - Exonic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
915149748 1:153821089-153821111 TACTCAGGAGGCTGAGGCGGGGG - Intronic
915322429 1:155063110-155063132 CCCTCAGGTGGCGGCGGCGGAGG - Intergenic
915641282 1:157228937-157228959 TTCCCAGGGGGAGGCTGCAGGGG - Intergenic
916533247 1:165678222-165678244 TACTCAGGAGGCTGAGGCGGGGG + Intronic
916623708 1:166530394-166530416 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
916758258 1:167793575-167793597 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
917141568 1:171841140-171841162 TGCCCCGGTGGTGGCGGCGGCGG + Intergenic
917846691 1:179026016-179026038 CTCCCCGGAGGCGGCGGGGGCGG + Exonic
918062660 1:181075323-181075345 TACCCAGGAGGCTGAGGCAGAGG + Intergenic
918282855 1:183023238-183023260 ACTCCAGGAGGCGGCGGGGGCGG - Intergenic
918808123 1:189077223-189077245 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
919651966 1:200159002-200159024 TTCTCAGGAGTCTGAGGCGGGGG - Intronic
920022703 1:202967386-202967408 CTAGCAGGAGGTGGCGGCGGCGG + Intergenic
920133669 1:203752721-203752743 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
920152923 1:203923937-203923959 TTCTCAGGAGGCTGAGGCAGAGG - Intergenic
920705007 1:208244296-208244318 TCCCGCGGTGGCGGCGGCGGCGG + Exonic
921005881 1:211093393-211093415 TACCCAGGAGGCTGAGGCAGGGG - Intronic
921060229 1:211578899-211578921 CACCCAGGCGGCGGCGGTGGCGG + Intergenic
921794539 1:219326987-219327009 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
922204848 1:223437195-223437217 TTCCCAGGAGGCTGGGGTTGTGG + Intergenic
922287548 1:224183261-224183283 CTCAGAGGTGGCGGCGGCGGCGG - Exonic
922288788 1:224192974-224192996 AACCCAGGAGGCGGAGGCAGAGG + Exonic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
922536189 1:226382633-226382655 TACTCAGGAGGCTGAGGCGGAGG - Intronic
922727526 1:227929722-227929744 TACTCAGGAGGCTGAGGCGGGGG + Intronic
922958592 1:229625913-229625935 GATCCCGGAGGCGGCGGCGGCGG - Exonic
923055856 1:230425746-230425768 GTCCGAGGAGGCGGCCGAGGAGG + Intergenic
923490312 1:234478533-234478555 TGCCGAGGACGCGGCGGCGCTGG - Exonic
923493658 1:234506412-234506434 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924531260 1:244895819-244895841 TTCTCAGGAGCCTGAGGCGGAGG - Intergenic
1063139453 10:3243392-3243414 TGCTCAGGAGGCTGAGGCGGGGG + Intergenic
1063355945 10:5398308-5398330 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1063824605 10:9880068-9880090 AACCCGGGAGGCGGAGGCGGAGG - Intergenic
1064443055 10:15370887-15370909 TGGCGCGGAGGCGGCGGCGGCGG - Intronic
1064604968 10:17029712-17029734 TGCCCAGGAAGCGTTGGCGGTGG + Intronic
1064981869 10:21173841-21173863 GTTCCCGGGGGCGGCGGCGGCGG + Intronic
1065023094 10:21516901-21516923 AGCCAAGGCGGCGGCGGCGGCGG - Exonic
1065028578 10:21562895-21562917 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1065526082 10:26622526-26622548 CTCCCGGGAGGCGGCGGGGCAGG - Intergenic
1065589783 10:27252572-27252594 GCCCCTGGCGGCGGCGGCGGGGG - Intergenic
1065712825 10:28533495-28533517 CGCGCAGGCGGCGGCGGCGGCGG - Exonic
1066333221 10:34447693-34447715 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1066340666 10:34529842-34529864 TTCACAGGAGGCTGAGGCAGGGG - Intronic
1066341155 10:34534900-34534922 TTCTCAGGAGGCTGAGGCAGGGG + Intronic
1066429272 10:35336656-35336678 TTCCCCGGCGGCTGCGGCGACGG - Intronic
1066457548 10:35585208-35585230 GACCCAGAAGGCGGCAGCGGTGG - Intergenic
1067116056 10:43436564-43436586 TCCCCAAGAGCCGGCGGCAGAGG + Intergenic
1067243970 10:44520628-44520650 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1067306938 10:45072838-45072860 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
1067578234 10:47421037-47421059 TTCACAGGAGGCGGGGGCAGTGG - Intergenic
1067682766 10:48450925-48450947 TTCCCTGGACGGGGCGGCCGTGG - Exonic
1067696921 10:48542499-48542521 CTCACAGGAGGCGGAGGCAGAGG - Intronic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1068406802 10:56600294-56600316 AGCCCAGGAGGCGGAGGCTGTGG - Intergenic
1069019185 10:63466134-63466156 TCCAGAGGCGGCGGCGGCGGCGG + Intergenic
1070112033 10:73495822-73495844 GCCCCGGGAGGGGGCGGCGGGGG + Exonic
1070146727 10:73779483-73779505 AACCCAGGAGGCGGAGGTGGTGG + Intronic
1070570644 10:77637742-77637764 CTCCGCGGCGGCGGCGGCGGCGG - Intronic
1070800781 10:79243343-79243365 CTCCTCGGCGGCGGCGGCGGCGG + Intronic
1071434470 10:85634091-85634113 AACCCAGGAGGCGGAGGTGGCGG + Intronic
1071695957 10:87871570-87871592 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1071835735 10:89415232-89415254 TTTCCCGGAGGCGGCGGCCGCGG - Intronic
1072593975 10:96854402-96854424 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1072719502 10:97771934-97771956 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1072915539 10:99535509-99535531 TACCCGGCGGGCGGCGGCGGCGG + Exonic
1072977820 10:100074491-100074513 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1073061366 10:100735676-100735698 GCCCCAGGACGCGGCGGCCGCGG + Intronic
1073237815 10:102033526-102033548 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1073424571 10:103448641-103448663 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1073516268 10:104078045-104078067 CTCCCTGGAGGCGGGGGCAGGGG + Intronic
1074088355 10:110225914-110225936 TTCCCAGGGGGCAGAGGCAGGGG + Intronic
1074729530 10:116354644-116354666 AACCCAGGAGGCGGAGGCGGAGG + Intronic
1075011945 10:118879509-118879531 AACCCAGGAGGTGGAGGCGGAGG + Intergenic
1075697599 10:124448050-124448072 ATCCGAGGAGGCCGCGGCTGCGG - Exonic
1075757340 10:124824025-124824047 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1075802147 10:125160357-125160379 CACCCTGGAGGCGGCGGCGGCGG + Intronic
1075917225 10:126178967-126178989 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1076146389 10:128125928-128125950 CTCCCAGGAGGCGCAGGCGCTGG - Intronic
1076373073 10:129967283-129967305 CTCCGAGGAGGAGGCGGCGGCGG - Intergenic
1076544346 10:131234779-131234801 AACCCAGGAGGCGGAGGTGGCGG - Intronic
1076638911 10:131901016-131901038 CTCCCCGGCGGCGGCGGCGGCGG + Exonic
1076638986 10:131901231-131901253 TTTGCAGGAGCCGGAGGCGGCGG + Exonic
1076690851 10:132223275-132223297 TTGCCAGGAGGTGGCAGCCGAGG + Intronic
1076722035 10:132397012-132397034 CTCCCGGGACGCGGCGGCGGCGG + Intergenic
1076722084 10:132397159-132397181 TGACCCGGCGGCGGCGGCGGCGG + Exonic
1076844474 10:133062351-133062373 TTCCCAGGAGCGGACGGTGGTGG - Intergenic
1076859706 10:133134967-133134989 TGCCCAGGTGGCGGCGGTGGTGG + Intergenic
1077133939 11:989247-989269 AACCCGGGAGGCGGAGGCGGAGG + Intronic
1077198588 11:1293782-1293804 CTGCCAGGAGGTGGCGGCTGAGG + Intronic
1077234793 11:1475537-1475559 TACTCAGGAGGCTGAGGCGGTGG - Intronic
1077836300 11:5930511-5930533 TTCCCGAGAGGAGGCGGCTGAGG + Intronic
1079023104 11:16925012-16925034 TTGCCAGGAGCCGGCTACGGAGG - Intronic
1079033418 11:17002292-17002314 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1079064184 11:17275688-17275710 TACTCAGGAGGCGGAGGCAGAGG - Intronic
1079097267 11:17518941-17518963 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1079353683 11:19713643-19713665 GTCCCTGGCAGCGGCGGCGGGGG - Exonic
1079408062 11:20162570-20162592 TTCCCAGAAGGACGCGCCGGGGG + Intergenic
1080501747 11:32878094-32878116 TACTCAGGAGGCTGAGGCGGAGG - Intergenic
1081465391 11:43312060-43312082 TTCCGAGGCGGCGGTGGCGCCGG + Exonic
1081925748 11:46826818-46826840 TACCCGGCAGGCGGCGGCGGCGG + Intronic
1082843931 11:57712070-57712092 CCCGCAGGAGGCGGTGGCGGGGG + Exonic
1082928903 11:58579232-58579254 GTCCTAGGCGGCGGAGGCGGAGG - Exonic
1083567361 11:63730708-63730730 TACTCAGGAGGCTGAGGCGGAGG + Intronic
1083617964 11:64035775-64035797 TCCCCTCGCGGCGGCGGCGGCGG - Intronic
1083672134 11:64305631-64305653 GCCCGAGGAGGCGGCGGAGGAGG + Intronic
1083822426 11:65181010-65181032 TACCCAGGAGAGGGCGGCAGAGG - Exonic
1083967659 11:66052430-66052452 TGGCCTGGAGGTGGCGGCGGCGG - Exonic
1083970309 11:66070408-66070430 TTCCCCCGCGGCGGCGGCGGCGG - Intronic
1084129033 11:67119337-67119359 CTCCCCGGCAGCGGCGGCGGCGG + Intronic
1084233472 11:67770192-67770214 TACCCAGGAGGCGGAGGTTGCGG + Intergenic
1084275633 11:68049746-68049768 TCCGCAGGCGGCGGCGGTGGCGG - Exonic
1084275635 11:68049749-68049771 TCCTCCGCAGGCGGCGGCGGTGG - Exonic
1084301662 11:68256458-68256480 GTCCCAGGGGACAGCGGCGGGGG - Intergenic
1084481713 11:69425072-69425094 TTCCCAGGAGCAGGAGGAGGGGG + Intergenic
1085507718 11:77069651-77069673 TGCCCAGGAGGCTGCTGGGGAGG - Intronic
1085519182 11:77128193-77128215 CTCCCAGGAGGCGGAGCCGGAGG - Intergenic
1086322339 11:85664289-85664311 TCCCCAGGAGGAGGCGGCGGTGG - Exonic
1086887836 11:92224976-92224998 ACCCCCGGCGGCGGCGGCGGCGG + Intergenic
1087039486 11:93784675-93784697 CTCCGAGGAGGAGGAGGCGGCGG + Exonic
1087118101 11:94544940-94544962 CTACGAGGAGGCAGCGGCGGCGG + Exonic
1087755791 11:102053471-102053493 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1087763973 11:102129884-102129906 AACCCAGGAGGCGGAGGCGGAGG - Intronic
1088277254 11:108100917-108100939 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1089582637 11:119490964-119490986 TTCCCAGGAGACGGTGCTGGAGG - Intergenic
1089875992 11:121722750-121722772 CTCTCAGGAAGCGGCGGGGGTGG + Intergenic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1090194046 11:124800078-124800100 GCCCCGGCAGGCGGCGGCGGCGG + Exonic
1090194056 11:124800112-124800134 TCCCCTGGTGGCGGCGGTGGCGG - Exonic
1090537393 11:127658790-127658812 GGAGCAGGAGGCGGCGGCGGTGG - Intergenic
1090730109 11:129565127-129565149 CTCCCAGGAGGAGGGGGCAGGGG + Intergenic
1090820709 11:130338897-130338919 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
1091447840 12:554105-554127 TTCCCAGGAGCCTGAGTCGGGGG - Intronic
1091505484 12:1063368-1063390 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1091558584 12:1594167-1594189 GCCCGAGGCGGCGGCGGCGGCGG - Intronic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1091823165 12:3491294-3491316 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1092103104 12:5902478-5902500 TACCCAGGAGGCCAAGGCGGAGG + Intronic
1092119453 12:6033864-6033886 TTCCCAGGAGGAGGAGGGGCGGG - Intronic
1092176028 12:6407856-6407878 ACCCCAGGAGGCGGAGGAGGCGG - Intergenic
1092672717 12:10882302-10882324 TTTCCAGGAGGAGGTGGGGGAGG + Exonic
1092676977 12:10930973-10930995 TTTCCAGGAGGAGGTGGGGGAGG - Exonic
1093039882 12:14365684-14365706 ATCTGCGGAGGCGGCGGCGGTGG + Intronic
1093547928 12:20369557-20369579 GTGTAAGGAGGCGGCGGCGGCGG + Exonic
1093958795 12:25250910-25250932 TTCCTAGGCGGCGGCCGCGGCGG - Intronic
1093996677 12:25650523-25650545 TTCTCAGGAGGCTGAGGCAGGGG - Intergenic
1094234333 12:28146262-28146284 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1094773545 12:33694862-33694884 ATCCCAGGAGGCGGAGGTTGTGG - Intergenic
1095426561 12:42080994-42081016 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
1095885150 12:47181091-47181113 TACCCAGGAGGCTGAGGTGGGGG - Intronic
1096109993 12:49022937-49022959 ATCCCAGGAGGTGGCAGAGGAGG - Intronic
1096460771 12:51820589-51820611 GTGCCAGCAGGCGGCGGCCGGGG - Intergenic
1096593080 12:52675338-52675360 GGCTCTGGAGGCGGCGGCGGCGG - Exonic
1096593132 12:52675557-52675579 AGCCGAGGAGGTGGCGGCGGTGG - Exonic
1096727362 12:53575327-53575349 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1096758535 12:53820015-53820037 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
1096809768 12:54161851-54161873 CTCCCAGGCGGAGGCGGCAGTGG + Intergenic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1097043007 12:56167268-56167290 TTCCCAGGAGGCGGACGTTGTGG + Intronic
1097057440 12:56258341-56258363 GGCCCAGGCGGCGGCTGCGGTGG + Exonic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097264418 12:57737512-57737534 TCCCCCGGCGGCGGCGGCGGTGG + Exonic
1098121520 12:67245465-67245487 TACTCAGGAGGCTGCGGTGGGGG + Intergenic
1098161156 12:67649041-67649063 CGGCCGGGAGGCGGCGGCGGCGG + Exonic
1098320570 12:69239602-69239624 CCTGCAGGAGGCGGCGGCGGCGG + Exonic
1098348658 12:69533425-69533447 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1098891857 12:76017525-76017547 TTCTCAGGAGGCTGAGGCAGGGG + Intergenic
1099004621 12:77221476-77221498 TACTCAGGAGGCTGAGGCGGAGG + Intergenic
1099294420 12:80812627-80812649 AACCCAGGAGGCGGAGGTGGTGG - Intronic
1100565560 12:95790685-95790707 CGCCCAGGAGGAGGCGGCGGCGG - Exonic
1100869442 12:98894979-98895001 TGCCCTGGCGGCAGCGGCGGCGG + Intronic
1101023150 12:100573679-100573701 GGCCCAGGCGGCGGCGGCAGCGG + Intronic
1101354740 12:103966214-103966236 TTCCCTGGCTGCGGCGGTGGTGG + Intronic
1101592695 12:106138566-106138588 TCCCCGAGAGGCGGTGGCGGGGG - Exonic
1101965437 12:109279189-109279211 TCCCCCGGAGGCTGCGGCTGAGG + Exonic
1102003571 12:109573848-109573870 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1102254055 12:111406024-111406046 TTCCCCGGCGGCGGCGGCCCGGG + Exonic
1102277989 12:111598201-111598223 TTCCCAGGACTCGGAGGGGGCGG + Intronic
1102453296 12:113056883-113056905 AGCCCAGGAGGCGGCGGTGCTGG + Intronic
1102457141 12:113077861-113077883 CCTCCAGGTGGCGGCGGCGGCGG - Exonic
1102519934 12:113471805-113471827 TTCCCCGGTGGCGGAGGCGCCGG + Exonic
1102989213 12:117302853-117302875 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1103623895 12:122204563-122204585 ATGCCGGGCGGCGGCGGCGGCGG - Exonic
1103800346 12:123533712-123533734 TCCCGAGTGGGCGGCGGCGGCGG + Exonic
1103808277 12:123591835-123591857 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1103879215 12:124153166-124153188 AACCCAGGAGGCGGCGGTTGTGG - Intronic
1103932225 12:124456973-124456995 TGCCCAGGCGGCGTCCGCGGAGG - Intronic
1103950091 12:124545749-124545771 TTCCCAGCACGGGGCGGCGCAGG - Intronic
1103950206 12:124546490-124546512 AACCCAGGAGGTGGAGGCGGAGG - Intronic
1103954249 12:124567586-124567608 CTCCCCGGCGGCCGCGGCGGCGG + Intronic
1104088244 12:125494349-125494371 TTCCAGGGAGGAGGGGGCGGAGG - Intronic
1104426561 12:128682837-128682859 TTCCCTGGAGGCCTCGGAGGAGG - Intronic
1104649483 12:130521403-130521425 TTCCCAGGAGGAGGAAGAGGAGG + Intronic
1104887985 12:132122780-132122802 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1104953795 12:132454156-132454178 TTCCCAGGAGGCCCGGGCTGGGG - Intergenic
1104992297 12:132632679-132632701 CTCCCAGGAGGCCGAGGGGGCGG - Exonic
1105033423 12:132901170-132901192 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1105493239 13:20907437-20907459 TACTCAGGAGGCGGAGGCAGGGG - Intergenic
1106006258 13:25772835-25772857 AACCCAGGAGGCGGAGGCGGAGG - Intronic
1106036912 13:26051732-26051754 TGCCCAGCTGGCGGCGGCCGCGG + Intergenic
1106099553 13:26682656-26682678 ATCACAGGAGGAGGTGGCGGAGG - Exonic
1106208406 13:27620502-27620524 ATCCGCGGCGGCGGCGGCGGCGG - Intergenic
1106322962 13:28659270-28659292 GTCCCCGGTGGCGGCGGCGGCGG + Intronic
1106359649 13:29018769-29018791 TTTGCAGGGGGCGGGGGCGGGGG - Intronic
1106512388 13:30422369-30422391 CTCCCTGGCCGCGGCGGCGGTGG + Intergenic
1107280576 13:38728911-38728933 ATCCCAGGAGGCGGAGGTTGTGG - Intronic
1107306798 13:39030529-39030551 TACCCAGGAGGCTGCGGCAGGGG - Intronic
1107468073 13:40666769-40666791 TTTCCACGGGGAGGCGGCGGTGG + Intergenic
1107619181 13:42207297-42207319 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1107851781 13:44577890-44577912 TTCCCAGGAGCCCGCCGCCGCGG + Intergenic
1108227458 13:48303947-48303969 TTCCGCGGCGGCAGCGGCGGCGG - Exonic
1108227470 13:48303982-48304004 TCCTCAGGAGGGGGCGGCGGCGG - Exonic
1108685427 13:52815335-52815357 TGCCCAGGAGCCGGCGGCGGGGG + Intergenic
1108938301 13:55914763-55914785 TACCCAGGAGGCGGAGGCTGTGG - Intergenic
1109284853 13:60397592-60397614 TCCCCTGGAGGCGGCGGCGGCGG + Intronic
1110217933 13:73044129-73044151 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
1110596581 13:77326728-77326750 CCCCGAGGAGGCGGCGGCGGGGG + Intronic
1110705922 13:78602145-78602167 GGCCCGGGGGGCGGCGGCGGCGG - Exonic
1110964291 13:81672895-81672917 TTCTCAGGAGGCTGAGGCAGGGG - Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112453402 13:99533778-99533800 TACTCAGGAGGCGGAGGTGGAGG - Intronic
1112504916 13:99969809-99969831 CTCCGAGGTGGCGGCGGCGGCGG + Intronic
1112576541 13:100641563-100641585 AACCCAGGAGGCGGAGGTGGCGG - Intronic
1113020314 13:105877676-105877698 GTGGCAGGAGGCGGCGGTGGGGG + Intergenic
1113036364 13:106053615-106053637 TACTCAGGAGGCTGAGGCGGAGG + Intergenic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113295607 13:108955739-108955761 TACCCAGGAGGCTGAGGCAGCGG + Intronic
1113378125 13:109782935-109782957 TCCCCCGGGGCCGGCGGCGGTGG + Exonic
1113543844 13:111131251-111131273 AGCCCAGGAGGGTGCGGCGGCGG + Intronic
1113546223 13:111153451-111153473 TGGACAGGAGGAGGCGGCGGTGG + Intronic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1114487537 14:23071776-23071798 TTCCCAGGGGGCAGGGGAGGGGG + Intronic
1114879656 14:26768670-26768692 AGCCCAGGAGGTGGAGGCGGAGG - Intergenic
1115685332 14:35790576-35790598 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1117526656 14:56613984-56614006 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1117602571 14:57390638-57390660 TGCGAAGGAGGCGGCGGCGGTGG + Exonic
1117926372 14:60784088-60784110 AACCCAGGAGGCGGAGGCGGAGG - Intronic
1118186538 14:63543125-63543147 TGCCCCGGACCCGGCGGCGGCGG + Exonic
1118189494 14:63567542-63567564 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1118607698 14:67515403-67515425 GCCCCCGGCGGCGGCGGCGGCGG + Intronic
1118627699 14:67674463-67674485 CTCCGAGGAGGCGGCGGAGGAGG + Exonic
1118971505 14:70641916-70641938 GTCCGAGGCGGCGGCGGCGGCGG + Exonic
1119196248 14:72718847-72718869 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1119397990 14:74342123-74342145 TCCTCAGGAGGCAGAGGCGGAGG + Intronic
1119497350 14:75091442-75091464 AGCCCGGGAGGAGGCGGCGGGGG - Exonic
1119569023 14:75653522-75653544 AACCCAGGAGGCGGAGGTGGAGG + Intronic
1119587579 14:75850982-75851004 TACTCAGGAGGCGGAGGTGGCGG + Intronic
1121309686 14:92929105-92929127 GTCAGAGGAGGCAGCGGCGGCGG + Intronic
1121769498 14:96520451-96520473 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1122108759 14:99480797-99480819 CCCCCAGGCGGTGGCGGCGGTGG + Exonic
1122429967 14:101634485-101634507 TTCCCAGGAGGCTGCTGTGGGGG + Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122610219 14:102977227-102977249 TACTCAGGAGGCTGCGGCAGGGG + Intronic
1123487716 15:20756059-20756081 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1123544208 15:21325117-21325139 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1123675785 15:22709600-22709622 AACCCAAGAGGCGGAGGCGGCGG - Intergenic
1124327782 15:28782523-28782545 AACCCAAGAGGCGGAGGCGGCGG - Intergenic
1124484434 15:30102501-30102523 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124497527 15:30195697-30195719 TTCCCAGGCGGTAGCGGGGGCGG + Intergenic
1124500370 15:30223083-30223105 GCCCCCGGAGGCGGCGGAGGAGG + Intergenic
1124519149 15:30394723-30394745 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1124539507 15:30571498-30571520 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124743203 15:32315583-32315605 GCCCCCGGAGGCGGCGGAGGAGG - Intergenic
1124746062 15:32342994-32343016 TTCCCAGGCGGTAGCGGGGGCGG - Intergenic
1124759143 15:32436074-32436096 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1124974460 15:34520182-34520204 TTCCATGGTGGCAGCGGCGGTGG + Intergenic
1125042571 15:35208197-35208219 GTCCCTGGAGGTGGTGGCGGGGG + Intergenic
1125852803 15:42920628-42920650 TTTACTGGCGGCGGCGGCGGCGG + Intronic
1126113289 15:45187761-45187783 TTCCGCGGGGGGGGCGGCGGCGG - Intronic
1126113310 15:45187818-45187840 GGCCCAGGAGGGGGCGGCAGCGG - Intronic
1126786219 15:52179696-52179718 TTCCCGGGCGGGGACGGCGGGGG - Intronic
1126837066 15:52678719-52678741 TCCCCCGGAGCCGGCCGCGGAGG - Intronic
1127103230 15:55588189-55588211 GTGGGAGGAGGCGGCGGCGGCGG - Intronic
1127260898 15:57325466-57325488 GCCTCAGGAGGCGGCAGCGGTGG + Intergenic
1127413164 15:58729882-58729904 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1127515605 15:59689988-59690010 TACTCAGGAGGCGAGGGCGGAGG + Intergenic
1127763574 15:62164450-62164472 CGCGCAGGAGGCGGCAGCGGCGG + Exonic
1128065448 15:64761784-64761806 AACCCAGGAGGCGGAGGTGGAGG - Intronic
1128202429 15:65820786-65820808 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1128454818 15:67826672-67826694 CTACAAGGAGGCGGCGGAGGCGG + Intronic
1128892907 15:71346949-71346971 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1129209884 15:74062349-74062371 ATCCCAGGTGGCAGCGGTGGCGG + Intergenic
1129404145 15:75303053-75303075 CTCCCAGGTGGCAGCGGTGGCGG - Intergenic
1129477144 15:75793070-75793092 CTCCCAGGTGGCAGCGGTGGTGG - Intergenic
1129483107 15:75843380-75843402 TTCCCAGGCGGTAGCGGGGGCGG + Exonic
1129548115 15:76419249-76419271 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1129676039 15:77632810-77632832 AGCGCAGGCGGCGGCGGCGGCGG - Intronic
1129857927 15:78838138-78838160 AACCCAGGAGGAGGAGGCGGAGG + Intronic
1130115549 15:81001891-81001913 GCCCAAGAAGGCGGCGGCGGCGG + Exonic
1130360792 15:83183667-83183689 AACTCAGGAGGCGGAGGCGGAGG + Intronic
1130370802 15:83284336-83284358 CGGCCGGGAGGCGGCGGCGGGGG - Intronic
1130508770 15:84570981-84571003 TTCCCAGGCGGTAGCGGGGGCGG - Intergenic
1130564419 15:84981683-84981705 AGCCGGGGAGGCGGCGGCGGCGG + Intronic
1130656437 15:85794781-85794803 CTCTGAGGCGGCGGCGGCGGCGG - Exonic
1130908605 15:88256352-88256374 CTCCCACCCGGCGGCGGCGGCGG - Exonic
1131044703 15:89304852-89304874 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1131186089 15:90275286-90275308 TTCCACAGGGGCGGCGGCGGCGG + Exonic
1131486526 15:92825532-92825554 TTCTCAGGAGGCTGAGGCAGGGG - Intergenic
1131877459 15:96825626-96825648 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1132099543 15:99014228-99014250 TTTTGAGGAGGCTGCGGCGGAGG - Intergenic
1132185928 15:99801579-99801601 TTCCCTGGTGGCAGCGGCGGTGG - Intergenic
1132218983 15:100090896-100090918 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1132429752 15:101751119-101751141 TTCCCTGGTGGCAGCGGCGGTGG + Intergenic
1202952551 15_KI270727v1_random:52388-52410 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1132584679 16:700957-700979 TCCGGAGGAGGCGGCGGGGGCGG + Intronic
1132684466 16:1156525-1156547 TTTGCAGGAGGCGGCAGGGGCGG + Intronic
1132753153 16:1468274-1468296 TGCCAAGGCGGCGGCGGTGGGGG - Intronic
1132784288 16:1646266-1646288 TCCCCAGGAGGAGGAGGAGGTGG + Intronic
1132841029 16:1978639-1978661 TTCCCAGGGGGTGGGGGCGGCGG - Exonic
1132877961 16:2148666-2148688 TCCCCTGGCGGCGGCGGCGGCGG - Exonic
1133029944 16:3005726-3005748 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
1133464723 16:6018926-6018948 ATTCCAGCGGGCGGCGGCGGCGG - Intergenic
1133596468 16:7298364-7298386 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1133791613 16:9013406-9013428 CTCCCGGGAGGAGGAGGCGGCGG + Intergenic
1134163952 16:11915555-11915577 CTCCCTGGCGGCGGCGGCCGAGG - Exonic
1134326007 16:13208517-13208539 AACCCAGGAGGCGGCGGTTGTGG - Intronic
1134441665 16:14302515-14302537 ACCCCCGGAGGCGGCAGCGGCGG + Intergenic
1134552523 16:15144654-15144676 TTCCCAGGATGAGACGCCGGGGG + Intergenic
1134787633 16:16959622-16959644 AACCCAGGAGGCAGAGGCGGAGG - Intergenic
1134824221 16:17271751-17271773 TTCCCAGCAGGGGTCGGGGGTGG - Intronic
1135023798 16:18983990-18984012 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1135182425 16:20287374-20287396 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1135309972 16:21397795-21397817 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1135362866 16:21829900-21829922 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1135425408 16:22331086-22331108 TACTCAGGAGGCTGAGGCGGAGG - Intronic
1135448922 16:22541167-22541189 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
1135553021 16:23412793-23412815 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1135691316 16:24539911-24539933 GTCCGAGGCGGCGGCGGCGGCGG + Intronic
1136149552 16:28338131-28338153 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1136248740 16:28989943-28989965 TTCCCAGGAGGCAGAGGAAGTGG + Exonic
1136306717 16:29376926-29376948 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136365678 16:29808043-29808065 GTGGGAGGAGGCGGCGGCGGCGG + Intronic
1136750202 16:32628654-32628676 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1137280070 16:46968935-46968957 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1137618203 16:49858855-49858877 ATCCCAGGCGCCGGCGGGGGTGG - Intergenic
1137655256 16:50153549-50153571 TGCGCCTGAGGCGGCGGCGGCGG + Intronic
1137708031 16:50548683-50548705 TCGCGAGGCGGCGGCGGCGGCGG - Intronic
1138117305 16:54370729-54370751 CTCTCAGGAGGCGGCGGGAGGGG + Intergenic
1138117319 16:54370812-54370834 TTCCGAGCAGGCGGCTGAGGAGG - Intergenic
1138171185 16:54851099-54851121 TACTCAGGAGGCGGAGGCAGGGG - Intergenic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1138334256 16:56240172-56240194 TTCCCTGGAGGCTGCTGAGGTGG - Intronic
1138348684 16:56335135-56335157 TTCCAAGGAGGAGGAGGAGGTGG + Intronic
1138501449 16:57447499-57447521 TTCCAAAATGGCGGCGGCGGCGG + Exonic
1138519783 16:57564417-57564439 ATCCCAGGAGGCTGAGGCAGGGG - Intronic
1138619190 16:58198016-58198038 CCCCCAGGAGGCGGCGGCGGCGG + Intergenic
1139220568 16:65177309-65177331 TTCTCAGGAGGCTGAGGAGGGGG + Intergenic
1139466139 16:67155125-67155147 TGGGCAGGTGGCGGCGGCGGCGG + Exonic
1139536398 16:67577545-67577567 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1139677985 16:68538626-68538648 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1139904844 16:70357142-70357164 TACTCAGGAGGCGGAGGCTGAGG + Intronic
1139936459 16:70575274-70575296 AACCCAGGAGGCGGAGGCTGTGG - Exonic
1139994533 16:70967589-70967611 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1140209184 16:72957817-72957839 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
1140223310 16:73058910-73058932 TGCAAAGCAGGCGGCGGCGGCGG + Intronic
1140430848 16:74901528-74901550 TACTCAGGAGGCGGCTGAGGTGG + Intronic
1140633359 16:76881383-76881405 TACCCAGGAGGCTGAGGCCGGGG + Intergenic
1140804218 16:78518307-78518329 ATCCCAGGAGGCGGAGGCTGCGG - Intronic
1141079179 16:81035876-81035898 GGCCTCGGAGGCGGCGGCGGCGG + Exonic
1141079181 16:81035879-81035901 CTCGGAGGCGGCGGCGGCGGCGG + Exonic
1141440485 16:84026577-84026599 TACCCAGGAGGTGGTGGCAGTGG + Intronic
1141692083 16:85602225-85602247 TTGCCTGGAGGCCGAGGCGGGGG + Intergenic
1141703416 16:85652540-85652562 ATTCCAGGCGGCGGCGGCGGCGG + Intronic
1141835774 16:86538315-86538337 TTCCAGGGTGGCGGCGGCAGTGG + Intronic
1142245972 16:88970177-88970199 ACTCCAGGAGGCGGTGGCGGCGG + Intronic
1142344895 16:89547688-89547710 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1142762420 17:2050230-2050252 GTCCCCGGGCGCGGCGGCGGCGG + Intergenic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142816168 17:2427685-2427707 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1142982395 17:3679747-3679769 TTCCCAGGAGGCCGAGGACGAGG - Exonic
1143077055 17:4353138-4353160 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1143251134 17:5523999-5524021 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1143590787 17:7885065-7885087 TTACCTGGCGGCGGGGGCGGCGG - Exonic
1143604760 17:7976428-7976450 TTCTCAGGAGGCTGAGGCAGGGG - Intergenic
1143976270 17:10832268-10832290 AACCCAGGAGGCGGCGGTTGCGG - Intronic
1144021037 17:11240647-11240669 TGCAGAGGCGGCGGCGGCGGCGG - Intergenic
1144058115 17:11559261-11559283 CTCCCAGGAGGCACCTGCGGTGG + Exonic
1144269234 17:13601266-13601288 GTCCCGGGAGGCAGCGGCCGGGG + Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144682749 17:17206250-17206272 TTGGCAGGTGGCGGCCGCGGCGG - Exonic
1144910060 17:18673040-18673062 TCCCCAGGCGGCGGCGGCGGCGG - Exonic
1145277521 17:21442103-21442125 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145294686 17:21578817-21578839 TTCCCAGGAGGCAGAGGAGCAGG - Intergenic
1145315357 17:21727997-21728019 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145713790 17:26999934-26999956 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145882106 17:28359825-28359847 AACCCAGGAGGCGGAGGCAGAGG + Intronic
1145969566 17:28949279-28949301 TTCCTAAGAGGCAGCGGCGCCGG + Intronic
1146058655 17:29593411-29593433 TCCTCGCGAGGCGGCGGCGGCGG - Intronic
1146259928 17:31414639-31414661 TTCCCAGGAGGCGGTGGCCTGGG + Intronic
1146646329 17:34579612-34579634 CGCCGAGGAGGCGGCGACGGCGG + Intergenic
1147440209 17:40443286-40443308 TTCAGATGCGGCGGCGGCGGCGG + Intergenic
1147684978 17:42281782-42281804 GTCCCAAGAGGCGGGGTCGGGGG - Intergenic
1147970980 17:44219089-44219111 CTCCCCGGAGGCCGGGGCGGGGG - Intronic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1148223418 17:45881349-45881371 AGCCCAGGAGGCGGAGGCTGCGG + Intergenic
1148417471 17:47517996-47518018 AACCCGGGAGGCGGAGGCGGAGG + Intergenic
1148437173 17:47693985-47694007 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1148562657 17:48614714-48614736 TTTTGAGGCGGCGGCGGCGGCGG + Exonic
1148829541 17:50422307-50422329 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
1148899443 17:50865663-50865685 CTCCCAGGAGCCCGGGGCGGGGG - Intronic
1148931393 17:51130096-51130118 AACCCAGGAGGCGGAGGCAGAGG - Intergenic
1148936235 17:51166410-51166432 CACCCGGGAGCCGGCGGCGGAGG - Intronic
1149430527 17:56593394-56593416 CTCACAGGCGGCGGCGGCGGCGG - Intergenic
1149430558 17:56593493-56593515 CGCCGCGGAGGCGGCGGCGGCGG - Intergenic
1149461538 17:56833692-56833714 ATCCCCGGCGGCGGCGGCGCCGG + Exonic
1150101848 17:62430941-62430963 ATCCCAGGAGGCGGAGGTTGCGG - Intronic
1150104236 17:62450369-62450391 TACTCAGGAGGCTGAGGCGGAGG - Intronic
1150373503 17:64661881-64661903 GTCCCCGGCGGCGGGGGCGGCGG + Exonic
1150423168 17:65056598-65056620 CGCCGAGGCGGCGGCGGCGGCGG - Exonic
1150770923 17:68040000-68040022 AACCCAGGAGGCGGAGGTGGTGG + Intronic
1151755336 17:76072451-76072473 GTCCCAGGCGGCGGCGGCGGCGG - Exonic
1151959561 17:77398492-77398514 TTCCCAAGAGGAGGAGGAGGCGG + Intronic
1152049142 17:77958952-77958974 GTCCTAGGCGGCGGCGGCGGCGG - Intergenic
1152077508 17:78168584-78168606 TTCCGCGGCGGCGGCAGCGGCGG + Exonic
1152147612 17:78577637-78577659 TTCTCAGGAGGCTGAGGGGGGGG - Intergenic
1152339484 17:79716298-79716320 CACCCAGGAGGCGGTGGGGGAGG + Intergenic
1152579972 17:81161547-81161569 TTCCCAGGCGGCCGGGGTGGTGG + Intronic
1152662619 17:81549937-81549959 TGCCCAGGAGGCGCTTGCGGTGG + Intronic
1152701341 17:81821449-81821471 TTCCCAGGAGGAGGAGGGGTGGG - Intergenic
1152718663 17:81911750-81911772 GTTCCCGGAGGTGGCGGCGGTGG - Intergenic
1152782629 17:82232904-82232926 TTCCTGGGGGGCGGCGGGGGGGG + Intronic
1152864987 17:82717019-82717041 TTCCCCGCAAGGGGCGGCGGCGG - Intronic
1152921369 17:83068173-83068195 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921384 17:83068208-83068230 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921398 17:83068242-83068264 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921409 17:83068276-83068298 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921422 17:83068310-83068332 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921434 17:83068344-83068366 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921445 17:83068378-83068400 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921458 17:83068412-83068434 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921472 17:83068446-83068468 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921483 17:83068480-83068502 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921496 17:83068514-83068536 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921510 17:83068548-83068570 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921521 17:83068582-83068604 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921534 17:83068616-83068638 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921547 17:83068650-83068672 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921561 17:83068684-83068706 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921575 17:83068719-83068741 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921589 17:83068754-83068776 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921603 17:83068789-83068811 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921616 17:83068823-83068845 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921631 17:83068858-83068880 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1153209104 18:2739838-2739860 TACCCAGGAGGCTGAGGCGAGGG + Intronic
1153235963 18:2987927-2987949 TACTCAGGAGGCTGAGGCGGAGG + Intronic
1153238882 18:3013218-3013240 TTCCAAGGCAGCGGCGGCTGCGG - Intronic
1153442287 18:5133316-5133338 TCCCAAGGAGGCAGCGGCAGAGG + Intergenic
1154116269 18:11614909-11614931 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1154268213 18:12897119-12897141 TGCCGCGGCGGCGGCGGCGGCGG - Intronic
1154297323 18:13162259-13162281 ATCCCAGGAGGTGGAGGCAGTGG + Intergenic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1156084574 18:33382976-33382998 TTCCCAGGAGGCAGGGGCAGGGG + Intronic
1157081419 18:44529420-44529442 TACTCAGGAGGCGGAGGCTGAGG + Intergenic
1157260788 18:46174190-46174212 TTCCGAGGAGGAGAAGGCGGCGG + Exonic
1157763465 18:50281464-50281486 TTCAGAGGAGGCGGCCGCGGAGG - Exonic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1158404258 18:57147188-57147210 CCCCAAGGAGGCAGCGGCGGAGG - Exonic
1158604671 18:58885064-58885086 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1158884693 18:61816004-61816026 TCCCCAGGAGGCGGTGGAGGAGG - Exonic
1158938325 18:62384845-62384867 CTCGCAGGAGGGCGCGGCGGCGG + Exonic
1159040575 18:63320029-63320051 TTCGCTGGCAGCGGCGGCGGCGG + Exonic
1160025390 18:75211668-75211690 CGCTCAGGAGGCGGCGGCGGCGG - Intronic
1160503845 18:79416595-79416617 TTCCCAGGAGGTGATGGCAGCGG - Intronic
1160710816 19:550214-550236 CTCCCAGGAGGGGGCGGCGTTGG + Intergenic
1160753536 19:746702-746724 TTCCCTGGAGGCGGCCTCCGTGG - Exonic
1160801444 19:971925-971947 AACAAAGGAGGCGGCGGCGGCGG + Exonic
1160843447 19:1156422-1156444 AAACCAGGAGGCGGAGGCGGAGG + Intronic
1160897156 19:1408206-1408228 CAACCAGGAAGCGGCGGCGGGGG - Intronic
1160945486 19:1641070-1641092 AACTCAGGAGGCGGAGGCGGAGG + Intronic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161359514 19:3839453-3839475 AACCCAGGAGGCGGAGGCGGAGG + Intronic
1161450698 19:4343848-4343870 AGCGGAGGAGGCGGCGGCGGCGG + Exonic
1161501869 19:4620690-4620712 TTCCCAGGAGGCGGAATGGGAGG + Intergenic
1161595547 19:5149412-5149434 TACCCAGGAGGCTGAGGTGGAGG - Intronic
1161702718 19:5804223-5804245 GTGCCAGGAGGGGGCGCCGGCGG + Intergenic
1161742555 19:6032229-6032251 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1161802716 19:6424736-6424758 AGCTGAGGAGGCGGCGGCGGCGG + Exonic
1161869020 19:6856217-6856239 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1161919106 19:7253003-7253025 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1161993554 19:7698820-7698842 TTCCCAGGAGGCGGTGTTGCAGG - Exonic
1162030903 19:7916867-7916889 CTCCCCGGAGGCGGCGGCAGCGG - Exonic
1162033202 19:7926047-7926069 CTCCCCGGCGGCGGCGGCGGCGG + Exonic
1162100214 19:8334650-8334672 TGCGGAGGAGGCAGCGGCGGGGG - Exonic
1162296076 19:9814585-9814607 TTCTCAGGAGGCTGAGGCAGGGG + Intronic
1162329843 19:10021063-10021085 TACTCAGGAGGCTGAGGCGGAGG + Intronic
1162364728 19:10241572-10241594 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
1162535844 19:11262483-11262505 GAACCGGGAGGCGGCGGCGGCGG - Intergenic
1162800555 19:13108066-13108088 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1162918746 19:13888293-13888315 GTTCCAGGACGCGGCGGCTGGGG + Intronic
1162965752 19:14155282-14155304 TACCCAGGAGAAGGCGGCGAGGG - Intronic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163146152 19:15380234-15380256 TCCTCTGGGGGCGGCGGCGGTGG + Exonic
1163536015 19:17876951-17876973 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1163547378 19:17948219-17948241 TGCCGAGGAGGTGGCGGGGGAGG + Intergenic
1163547481 19:17948518-17948540 TGCCGAGGAGGGGGCGGTGGGGG + Intergenic
1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG + Exonic
1163606977 19:18280981-18281003 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
1163662996 19:18589559-18589581 CTCCCGCGAGGCGGCGGCGAAGG - Exonic
1164189520 19:22901654-22901676 GTCCCAGGGGGTGGCGGCGCGGG + Intergenic
1164893759 19:31849985-31850007 TGCCCAGGAGGCTGAGGTGGGGG + Intergenic
1164942382 19:32261158-32261180 TACCCAGGAGGCTGAGGCAGGGG + Intergenic
1165159531 19:33807860-33807882 AACCCAGGAGGTGGAGGCGGAGG + Intronic
1165287230 19:34852337-34852359 AACCCAGGAGGCAGAGGCGGAGG - Intergenic
1165420036 19:35718012-35718034 TGCCAAGATGGCGGCGGCGGCGG + Exonic
1165581786 19:36871843-36871865 TACCCAGGAGGCGGAGGTTGTGG - Intronic
1165648527 19:37466547-37466569 TTCCCAGGAGGCGGAGGTTGCGG + Intronic
1165654695 19:37523129-37523151 TACCCAGGAGGCTGAGGTGGGGG - Intronic
1165812187 19:38618227-38618249 TACCTAGGAGACGGGGGCGGGGG - Intronic
1165941761 19:39417980-39418002 TTCCGAGGAGGCGGAGGGGGTGG + Exonic
1166078102 19:40425623-40425645 TCCCGAAGCGGCGGCGGCGGGGG + Intronic
1166361255 19:42253870-42253892 TCCCCCGGCGGCGGCGGCGGCGG - Intronic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1166810788 19:45513575-45513597 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1167001051 19:46746062-46746084 CTCCAAGATGGCGGCGGCGGCGG + Exonic
1167001776 19:46749613-46749635 TACTCAGGAGGCGGAGGCAGGGG + Intronic
1167148119 19:47694634-47694656 GTCCGAGGAGGCGGTGGGGGGGG - Exonic
1167149651 19:47701556-47701578 GTCCAAGGAGGAGGCGGCAGAGG - Exonic
1167269321 19:48498784-48498806 GCCCGAGGAGGTGGCGGCGGGGG + Exonic
1167419839 19:49396330-49396352 AACCCAGGAGGCGGGGGTGGCGG - Intronic
1167518177 19:49935549-49935571 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1167622349 19:50567158-50567180 TTTCCAGGAGGGGAGGGCGGAGG + Intronic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1168064055 19:53909421-53909443 GACCCCGGTGGCGGCGGCGGCGG + Exonic
1168100241 19:54137748-54137770 GTCCAAGATGGCGGCGGCGGAGG - Intronic
1168145967 19:54420388-54420410 TTCCCAGGCTGCGGGGGCTGGGG - Intronic
1168247007 19:55117495-55117517 TGGCCCGGGGGCGGCGGCGGCGG - Exonic
1168276076 19:55279520-55279542 TCTTCAGGGGGCGGCGGCGGCGG - Exonic
1168424421 19:56227415-56227437 TGCTCAGGAGGCAGAGGCGGAGG + Intronic
1168688224 19:58361432-58361454 TACCCAGGAGGCGGAGGTCGCGG - Intronic
926027204 2:9555727-9555749 TTCCCAGTAGGCGGCGCGGGAGG - Exonic
926291011 2:11530456-11530478 TTACCAGGAGGCTGAGGCAGGGG + Intergenic
927215826 2:20667354-20667376 AGCCCAGGGGGCGGCGGCGGCGG + Exonic
927369129 2:22334387-22334409 AGCCCAGGAGGCGGAGGCTGCGG - Intergenic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
927881456 2:26692707-26692729 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
928308786 2:30193218-30193240 TTCCCAGAAGCCGGCAGGGGAGG + Intergenic
928501565 2:31901797-31901819 TACTCAGGAGGCGGAGGCAGGGG + Intronic
928511848 2:32010347-32010369 AGCCCAGGAGGAGGCGGCAGCGG + Exonic
928520173 2:32081034-32081056 AACCCAGGAGGCGGAGGCTGCGG - Intronic
928603711 2:32925128-32925150 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
928611626 2:32997398-32997420 TTCCCAGGAGGCTGAGGCAGAGG + Intronic
928904636 2:36356261-36356283 CTGCGAGGAGGAGGCGGCGGCGG + Exonic
929465010 2:42136554-42136576 TGCCCAGGAGGCAGAGGTGGAGG + Intergenic
929511451 2:42568684-42568706 TGAGGAGGAGGCGGCGGCGGCGG + Intronic
929648596 2:43654915-43654937 TACTCAGGAGGCTGAGGCGGGGG + Intronic
929857901 2:45651432-45651454 CGCCCAGGAGGCGGCGGCCCCGG + Intronic
929906513 2:46050749-46050771 TTCCCAGGACGTGGCTGGGGGGG - Intronic
929968887 2:46556067-46556089 TTGCCAGGAGACGGGGGAGGAGG - Intronic
930066687 2:47332947-47332969 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
930358226 2:50346888-50346910 TCGCCCGGGGGCGGCGGCGGCGG - Intronic
930656690 2:54014046-54014068 TACCCAGGAGGCTGAGGCAGGGG + Intronic
931253508 2:60552420-60552442 TTCGGCGGCGGCGGCGGCGGCGG + Intronic
931254112 2:60555288-60555310 CTCCCCGGCGGCGGCGGCGGCGG - Intergenic
931352398 2:61503336-61503358 AACCCAGGAGGTGGAGGCGGAGG - Intronic
931516107 2:63051495-63051517 TTCGGAGGAGGCGGGGGAGGGGG - Intronic
931727713 2:65127646-65127668 AACCCAGGAGGCGGAGGTGGCGG + Intronic
932036535 2:68252191-68252213 CTCGCAGGAAACGGCGGCGGCGG + Exonic
932699847 2:73985056-73985078 GCCCCAGGCGGCGGCGGCGGCGG + Intergenic
933560176 2:83877780-83877802 TTCCCGAGAGGAGGCGGCTGAGG - Intergenic
933666862 2:84971285-84971307 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
933907959 2:86914013-86914035 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933907984 2:86914077-86914099 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908004 2:86914126-86914148 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908043 2:86914231-86914253 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908078 2:86914327-86914349 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908094 2:86914373-86914395 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908108 2:86914413-86914435 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908152 2:86914538-86914560 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908175 2:86914605-86914627 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908187 2:86914639-86914661 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908200 2:86914676-86914698 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908214 2:86914716-86914738 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908230 2:86914762-86914784 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908258 2:86914842-86914864 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908288 2:86914928-86914950 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
934011434 2:87824753-87824775 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011450 2:87824796-87824818 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011462 2:87824827-87824849 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011550 2:87825381-87825403 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011567 2:87825427-87825449 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
934638350 2:96010714-96010736 CTACCTGGCGGCGGCGGCGGCGG - Intergenic
934783297 2:96986541-96986563 TCCCCAGCTGGCGGCGGCGGCGG - Exonic
934795305 2:97094697-97094719 CTACCTGGCGGCGGCGGCGGCGG + Exonic
935149079 2:100417538-100417560 GTCCCGGGATGTGGCGGCGGCGG + Exonic
935301540 2:101697659-101697681 AACCCGGGAGGCGGAGGCGGAGG - Intronic
935592884 2:104857038-104857060 TGCGGAGGCGGCGGCGGCGGCGG - Exonic
936452790 2:112645992-112646014 TTCCCAGGAAGCAGCCGCGGGGG - Exonic
937283776 2:120737175-120737197 TTCCCCGGACGGGGCGGGGGCGG + Intronic
938073964 2:128322336-128322358 CTCCCTGGAGGAGGCGGCTGCGG - Intergenic
938091798 2:128439410-128439432 TACCCGGGAGGCAGCAGCGGAGG - Intergenic
938146355 2:128838024-128838046 TTCCTAGGAGGTGGGGGAGGGGG - Intergenic
938451544 2:131425332-131425354 TCGGCAGGCGGCGGCGGCGGCGG - Intergenic
938647599 2:133347473-133347495 AACCCAGGAGGCGGAGGCTGTGG + Intronic
939629761 2:144517174-144517196 AACCGAGGCGGCGGCGGCGGCGG - Intronic
940340791 2:152578646-152578668 TACTCAGGAGGCTGAGGCGGGGG - Intronic
941363152 2:164578121-164578143 TACCCAGGAGGCTGAGGCAGGGG + Intronic
941463108 2:165794150-165794172 AAGGCAGGAGGCGGCGGCGGAGG - Exonic
941686841 2:168456304-168456326 CGCGGAGGAGGCGGCGGCGGCGG + Exonic
941824116 2:169874244-169874266 AACCCAGGAGGCGGAGGCTGCGG - Intronic
941919458 2:170834877-170834899 TTCTCAGGAGGCTGAGGCAGGGG - Intronic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
942155319 2:173121754-173121776 TTCCCAGGAGGTGATGGTGGCGG - Intronic
942241113 2:173964680-173964702 CCCCCCGGCGGCGGCGGCGGCGG + Intronic
942450898 2:176107578-176107600 TACCGCGGCGGCGGCGGCGGCGG + Exonic
943345145 2:186730068-186730090 TACTCAGGAGGCTGAGGCGGGGG - Intronic
943725327 2:191246090-191246112 TGCCCCGGCGGCGGCGGGGGAGG + Intronic
944412440 2:199457718-199457740 GAACCCGGAGGCGGCGGCGGCGG + Exonic
944556005 2:200888601-200888623 AACCCGGGAGGCGGAGGCGGAGG - Intronic
944654194 2:201861636-201861658 TACCCAGGAGGCGGAGGCTGCGG - Intronic
944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG + Intergenic
944743681 2:202635410-202635432 GGCCCCGCAGGCGGCGGCGGCGG + Exonic
944743684 2:202635413-202635435 CCCGCAGGCGGCGGCGGCGGCGG + Exonic
945101835 2:206269645-206269667 AACCCAGGAGGTGGAGGCGGAGG - Intergenic
945648932 2:212537124-212537146 GGCAAAGGAGGCGGCGGCGGCGG + Intronic
945965698 2:216184590-216184612 TACTCAGGAGGCTGAGGCGGAGG - Intronic
946116272 2:217465214-217465236 TTCCCAGGGGGCTGTGGAGGTGG - Intronic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
946692399 2:222319461-222319483 TCGGCAGGCGGCGGCGGCGGCGG + Intergenic
946865609 2:224039112-224039134 TCCCCAGGGGGCGGCCGCGGAGG + Intronic
946905688 2:224413818-224413840 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
947122381 2:226830780-226830802 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
947601711 2:231455234-231455256 TTCCGAGGAGGCAGAGGAGGAGG - Exonic
947644775 2:231730545-231730567 TACTCAGGAGGCTGAGGCGGAGG - Intergenic
947860530 2:233354564-233354586 TCCTCGGGCGGCGGCGGCGGAGG - Exonic
948705525 2:239789954-239789976 TTCCCAGGAGGCAGCGTCGTGGG + Intronic
948809138 2:240466051-240466073 TTCCCAGGTGACGACGGCAGCGG + Exonic
1168757401 20:326562-326584 TGTCGGGGAGGCGGCGGCGGCGG - Exonic
1168757762 20:327843-327865 TTCCCAGGAGGGGGTGGGGAAGG - Exonic
1168785108 20:532272-532294 TACTCAGGAGGCTGAGGCGGGGG - Intronic
1168806703 20:675927-675949 TTCCCCTGAACCGGCGGCGGTGG + Exonic
1169065559 20:2692795-2692817 TCCCCCGGGAGCGGCGGCGGCGG + Intergenic
1169197514 20:3691523-3691545 CACCCAGGAGGCGGCAGCTGAGG + Exonic
1169656453 20:7929752-7929774 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1169800339 20:9507091-9507113 AGCCCAGGCGGCGGAGGCGGCGG - Intergenic
1170150419 20:13221468-13221490 CTGCCTGGCGGCGGCGGCGGCGG - Intergenic
1170617805 20:17968483-17968505 CGCCCAGGCGGCGGCGGCGGCGG - Intronic
1170677661 20:18497238-18497260 CTCCCAGGATGCCGCGGCGCAGG - Exonic
1170890036 20:20368679-20368701 CTCGGAGGGGGCGGCGGCGGCGG + Exonic
1171223540 20:23421578-23421600 TTCCCAGGAGGCCCCGGGGCGGG + Intergenic
1172342074 20:34166372-34166394 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
1172474459 20:35226678-35226700 GGCCGAGGCGGCGGCGGCGGCGG + Exonic
1172474494 20:35226781-35226803 TGGCCCGGCGGCGGCGGCGGCGG - Exonic
1172489358 20:35322622-35322644 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1173251756 20:41367231-41367253 TTCCAAAGAGGTGGCGGGGGAGG - Intergenic
1173634426 20:44542668-44542690 AACCCAGGAGGCGGAGGCTGAGG - Intronic
1173788571 20:45812876-45812898 GCTCCAGGAGGTGGCGGCGGGGG - Intronic
1173939102 20:46894855-46894877 AGCCCAGGAGGCGGAGGCAGCGG + Exonic
1173946506 20:46955212-46955234 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1174287769 20:49484196-49484218 TCCCGCGGCGGCGGCGGCGGCGG + Intergenic
1174317455 20:49713742-49713764 GGCCCAGGAGGCGGCGGACGGGG - Exonic
1174317464 20:49713763-49713785 GGCCCAGGCGGTGGCGGCGGCGG - Exonic
1174330406 20:49812962-49812984 TTCCCGGGCGGCGGAGGCGGCGG + Intronic
1174468037 20:50732002-50732024 TGCCGAGGAGGGGGTGGCGGGGG + Intronic
1175267059 20:57709532-57709554 CTGCCCGGCGGCGGCGGCGGCGG + Exonic
1175338105 20:58209660-58209682 TTCCCCGGTGGGGGCGGGGGCGG - Intergenic
1175349795 20:58309732-58309754 TCCCAAGATGGCGGCGGCGGCGG + Exonic
1175540318 20:59743982-59744004 TTCCGAGGAGGCGGGGGCAACGG - Intronic
1175712959 20:61235649-61235671 TTACCAGAAGGCGGCGGTGGCGG - Intergenic
1175808784 20:61846197-61846219 TTCCCAGGAGGCAGCCGTGAGGG - Intronic
1175856276 20:62122539-62122561 CGCCCAGGCGGAGGCGGCGGCGG + Exonic
1176207111 20:63895199-63895221 ACCCCGGGCGGCGGCGGCGGCGG - Exonic
1176286797 21:5022818-5022840 GTCCGAGGAGCGGGCGGCGGAGG + Intronic
1176952665 21:15064957-15064979 AACTCGGGAGGCGGCGGCGGAGG - Exonic
1177830826 21:26137048-26137070 TACTCAGGAGGCGGAGGTGGAGG - Intronic
1177834085 21:26170695-26170717 GCCCCGGGAGACGGCGGCGGTGG - Intronic
1178016071 21:28347299-28347321 TTCTCAGGAGGCTGAGGCAGGGG + Intergenic
1178307383 21:31501971-31501993 TTCCCAGGTGGCTGCGGATGGGG - Intronic
1178334666 21:31732273-31732295 TTTCCCGCCGGCGGCGGCGGCGG + Intergenic
1178839980 21:36130367-36130389 AGCCCAGGAGGAGGCGGCAGCGG - Intergenic
1178950680 21:36982948-36982970 AACCCAGAAGGCGGAGGCGGAGG + Intronic
1179357088 21:40670426-40670448 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1179457263 21:41508122-41508144 TAAGCAGGAGGCGGAGGCGGAGG - Intronic
1179561596 21:42219241-42219263 TGCCCCGGGGGCGGCGGCGGCGG - Exonic
1179775527 21:43659544-43659566 TGCACAGAAGGCGGCGGCGGCGG - Exonic
1179870384 21:44240657-44240679 GTCCGAGGAGCGGGCGGCGGAGG - Intronic
1180169212 21:46049183-46049205 TTCCCAGGTGGTGCCGGAGGAGG - Intergenic
1180252777 21:46600434-46600456 TACTCAGGAGGCTGAGGCGGAGG + Intronic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1180735219 22:18011468-18011490 CTCCCAGGAGGCGGAGGTTGCGG + Intronic
1180782787 22:18530078-18530100 TTTCCAGGAGGAGGGGGAGGCGG - Intronic
1180917831 22:19501100-19501122 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1180963413 22:19773241-19773263 CTCCCAGGAGGTGGCGGAGCAGG - Intronic
1181106628 22:20579519-20579541 TTCCCAGTATGTGGGGGCGGGGG + Intronic
1181126349 22:20704110-20704132 TTTCCAGGAGGAGGGGGAGGCGG - Intergenic
1181239677 22:21469416-21469438 TTTCCAGGAGGAGGGGGAGGCGG - Intergenic
1181478021 22:23180562-23180584 GTCCGAGGAGGCGGCGGCGGCGG + Exonic
1181725146 22:24806281-24806303 GTCCCAGGAGGCGGTGGCGGCGG - Intronic
1181764151 22:25079337-25079359 TCCTCAGGAGGCGGAGGCAGGGG - Intronic
1181828949 22:25543681-25543703 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
1182072791 22:27475435-27475457 TTCCCAGGAGGGGCAGGCAGAGG - Intergenic
1182175333 22:28280414-28280436 AACCCAGGAGGCGGAGGCGGAGG - Intronic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182380415 22:29883208-29883230 TTGTGAGAAGGCGGCGGCGGCGG + Exonic
1182419064 22:30239997-30240019 ATCCCAGGAGGTGGAGGCTGCGG - Intergenic
1182671658 22:32001128-32001150 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1183247211 22:36703229-36703251 TGCCCGGGCAGCGGCGGCGGCGG + Exonic
1183466706 22:37983796-37983818 GGCCGAGGCGGCGGCGGCGGCGG - Exonic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
1183720373 22:39558537-39558559 TTTCCCGGAGGCGGGGGTGGCGG + Intergenic
1183791324 22:40072752-40072774 TACTCAGGAGGCGGAGGCAGGGG + Intronic
1183822429 22:40357329-40357351 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1183851295 22:40590587-40590609 AACCCAGGAGGCGGAGGCGGAGG + Intronic
1183853178 22:40609179-40609201 TTCTCAGGAGGCTGAGGCAGGGG + Intronic
1183909150 22:41065399-41065421 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
1183969469 22:41465800-41465822 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1184219321 22:43089240-43089262 TGCCCGGGAGGCGGCGGCCTGGG + Intronic
1184395598 22:44235118-44235140 TTCTCAGGAGGCTGAGGCTGAGG - Intergenic
1184512015 22:44939493-44939515 TTCCCAGGTGGGGGCGGCAGAGG + Intronic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1184891018 22:47379231-47379253 GGCGAAGGAGGCGGCGGCGGAGG + Intergenic
1184891044 22:47379312-47379334 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891049 22:47379327-47379349 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891054 22:47379342-47379364 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1184898911 22:47431515-47431537 ATCCCAGGAGGCGGAGGTTGTGG + Intergenic
1184927083 22:47650543-47650565 TTCCCAGGCAGAGGTGGCGGAGG - Intergenic
1184932120 22:47689110-47689132 TTACCAGGGGCCGGCGGAGGAGG - Intergenic
1185006609 22:48280706-48280728 TTCCCTGGGGGCGGCGATGGGGG - Intergenic
1185033498 22:48458418-48458440 AACCCAGGAGGCGGAGGTGGCGG + Intergenic
1185043445 22:48517411-48517433 GTCCCAGGAGGAGGTGGTGGGGG - Intronic
1185055291 22:48575933-48575955 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1185287979 22:50010888-50010910 TTCCCAGCGGCCGGCGTCGGGGG + Intronic
1185374290 22:50474962-50474984 CTCCGCGGCGGCGGCGGCGGCGG + Exonic
1185389991 22:50554582-50554604 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1185409417 22:50674365-50674387 TTCCCCGGGGGCGGGGGCGGCGG - Intergenic
1185412588 22:50692811-50692833 AACCCAGGAGGCGGAGGTGGTGG - Intergenic
1203238468 22_KI270732v1_random:30915-30937 CGCCCCGGCGGCGGCGGCGGCGG - Intergenic
949970244 3:9397674-9397696 TCCCCCGGCAGCGGCGGCGGCGG - Intronic
950087633 3:10271804-10271826 AACCCAGGAGGCGGAGGCGGAGG - Intronic
950110715 3:10417055-10417077 TTCCCAGACGGCGGCGGGGGGGG + Intronic
950212639 3:11135404-11135426 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
950361694 3:12453832-12453854 TACCCGGGAGGCTGAGGCGGGGG + Intergenic
950729914 3:14948015-14948037 TTGCCACGGGGTGGCGGCGGCGG + Intronic
950778310 3:15369488-15369510 TTCTCAGGAGGCTGTGGCAGAGG - Intergenic
952241226 3:31532942-31532964 CTCGCACCAGGCGGCGGCGGCGG + Exonic
952241227 3:31532945-31532967 GCACCAGGCGGCGGCGGCGGAGG + Exonic
952740343 3:36728546-36728568 GTCCCAGGAGGAGGGGGAGGAGG - Intronic
953343739 3:42157518-42157540 TTCTCAGGAGGCGTCTGCTGTGG - Intronic
953705208 3:45225817-45225839 CCCGGAGGAGGCGGCGGCGGCGG - Exonic
953989872 3:47475814-47475836 CTCCCAAGCTGCGGCGGCGGCGG + Exonic
954097521 3:48340776-48340798 ATCCCAGGAGGCGGAGGTTGCGG + Intergenic
954210411 3:49093930-49093952 TGCAGCGGAGGCGGCGGCGGCGG - Exonic
954275592 3:49539821-49539843 CTCCCAGGAGGTGGCGCCAGAGG + Intergenic
954341381 3:49956741-49956763 AACCCAGGAGGCGGAGGCTGCGG - Intronic
955308022 3:57853861-57853883 GACCCAGGAGGCGGAGGCTGCGG + Intronic
955336172 3:58088123-58088145 AACCCAGGAGGCAGAGGCGGGGG - Intronic
955691175 3:61592049-61592071 AACCCAGGAGGCGGAGGCTGCGG - Intronic
955732246 3:61999121-61999143 AACCCAGGAGGCGGAGGCTGCGG - Intronic
955768561 3:62369041-62369063 GACCCAGGAGGCGGCGGCGGCGG + Intergenic
955911575 3:63863960-63863982 TCCCGCGGCGGCGGCGGCGGCGG - Intergenic
956678015 3:71753644-71753666 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
957054189 3:75431688-75431710 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
958949207 3:100399199-100399221 AACCCAGGAGGCGGAGGTGGTGG + Intronic
959359011 3:105366979-105367001 CTCGCAGGAGGCGGCGACGGGGG - Exonic
960602175 3:119469174-119469196 TTCCCGGGAGCCGGCCGCGCGGG - Intronic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
960925994 3:122795276-122795298 AAGCCGGGAGGCGGCGGCGGCGG + Exonic
961887850 3:130108061-130108083 AACCCAGGAGGCGGAGGCTGCGG - Intronic
962277960 3:134030048-134030070 GTCTGAGGGGGCGGCGGCGGCGG - Exonic
962301939 3:134250816-134250838 CAGCGAGGAGGCGGCGGCGGCGG - Intergenic
962678206 3:137771415-137771437 TTCCGGGGAGGCGGCGAGGGGGG + Intergenic
962726575 3:138234187-138234209 AACCCGGGAGGCGGAGGCGGAGG - Intronic
963223376 3:142835749-142835771 TACTCAGGAGGCTGAGGCGGAGG - Intronic
963259243 3:143176638-143176660 CTCCCAGGAGGAGGAGCCGGTGG + Intergenic
963798752 3:149657263-149657285 TGCCCAGGCGGCGGGAGCGGAGG + Exonic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
964273110 3:154979716-154979738 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
965828014 3:172750531-172750553 TGGCCAGGAGGTGGCGGTGGTGG - Intergenic
966473960 3:180322994-180323016 GTGCCAGGAGGCGGCAGCCGTGG + Intergenic
966866515 3:184261465-184261487 TGGGCAGGCGGCGGCGGCGGCGG + Intronic
967892165 3:194371204-194371226 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
968193606 3:196689140-196689162 AACCCGGGAGGCGGAGGCGGAGG + Intronic
968202333 3:196765391-196765413 TACTCAGGAGGCGGAGGTGGGGG - Intronic
968225187 3:196968747-196968769 GTCCCAGGAGGCCCCGGAGGCGG + Exonic
968850563 4:3074955-3074977 AGCTGAGGAGGCGGCGGCGGCGG - Exonic
968874052 4:3255964-3255986 AGGCCAGCAGGCGGCGGCGGCGG + Exonic
969294419 4:6261381-6261403 TTCCCAGGAGGCTGAGGTTGTGG + Intergenic
969600419 4:8172789-8172811 TTCCCAGCGGGCGGCGGAGCTGG - Intergenic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
969821681 4:9725576-9725598 TACCCAGGAGGCGGAGGTTGCGG - Intergenic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
970333027 4:15003754-15003776 CCCCCAGGAGGCGGAGGGGGAGG + Exonic
970376651 4:15464507-15464529 TACTCAGGAGGCCGAGGCGGGGG + Intergenic
970456241 4:16226634-16226656 TACCGTGGCGGCGGCGGCGGCGG - Intronic
971018948 4:22515684-22515706 CTGCTGGGAGGCGGCGGCGGCGG - Exonic
972321554 4:37977362-37977384 CTCCCCGGCGGCGGCGGCGGCGG - Intronic
972497440 4:39647124-39647146 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
974385662 4:61200577-61200599 GTCACAGGCGGCGGTGGCGGCGG - Intergenic
975986043 4:80202407-80202429 ATTCCCGGAGGAGGCGGCGGAGG + Exonic
976390016 4:84497705-84497727 AGCCCGGGCGGCGGCGGCGGCGG + Exonic
976600718 4:86935297-86935319 TTCCGAGAAGTCCGCGGCGGCGG - Intronic
976774907 4:88697697-88697719 TAGCCAGGCGGCGGCAGCGGCGG - Exonic
977257544 4:94757910-94757932 TCCCGCGGTGGCGGCGGCGGCGG + Intergenic
977566720 4:98587777-98587799 TTCTCAGGAGGCTGGGGCAGGGG + Intronic
977603641 4:98960398-98960420 TACCCAGGAGGCTGAGGCAGGGG + Intergenic
977890702 4:102308181-102308203 TTCCCAGGAGGCTCCAGCTGGGG - Intronic
978384642 4:108167733-108167755 TCCGGAGGAGGTGGCGGCGGCGG - Exonic
978541018 4:109816249-109816271 TTCCGAGGTGGAGGCGGCGGTGG + Exonic
978777203 4:112516018-112516040 AGCCCCGGCGGCGGCGGCGGCGG + Exonic
979283033 4:118888861-118888883 TTCGCAGCAGGCGGCTGGGGCGG + Exonic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
979785577 4:124712434-124712456 TAACCGGGGGGCGGCGGCGGCGG - Intronic
979785648 4:124712704-124712726 TGCCCTGACGGCGGCGGCGGCGG - Exonic
980129487 4:128805239-128805261 GACCCAGGAGGCGGAGGCTGCGG - Intergenic
980854040 4:138417591-138417613 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
980933315 4:139202359-139202381 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
980939910 4:139264134-139264156 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
983635727 4:169896204-169896226 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
984021225 4:174486924-174486946 AACCCAGGAGGCGGAGGCGGAGG + Intergenic
984206288 4:176792213-176792235 CTCGAAGGCGGCGGCGGCGGCGG + Exonic
984776244 4:183483494-183483516 CTCGGAGGAGGCGGCGGAGGTGG - Intergenic
984988389 4:185353478-185353500 TTCCCAGGAGGAGACAGAGGAGG + Exonic
984990661 4:185377438-185377460 ACCCCAGGAGGCGGAGGCTGCGG + Intronic
985086422 4:186317635-186317657 TACCCAGGAGGCTGAGGCAGGGG + Intergenic
985486337 5:153561-153583 TTCCCAGAAGGCGGCAGCTGTGG - Intronic
985696699 5:1344956-1344978 TTCCCCCGCGGCGGTGGCGGTGG - Exonic
985988349 5:3535874-3535896 TTCCCCGCAGGCGGCCGCCGTGG - Intergenic
986442096 5:7791800-7791822 TCCCCAGGAGGCGCCCACGGAGG - Intronic
986813658 5:11385159-11385181 TCCCGCGGCGGCGGCGGCGGCGG + Exonic
987491294 5:18583256-18583278 TACCCAGGAGGCTGAGGCTGAGG + Intergenic
988547791 5:32174283-32174305 CTCCAAGGCGGAGGCGGCGGCGG + Exonic
988735728 5:34019048-34019070 AACCCAGGAGGCGGAGGCTGCGG + Intronic
988980503 5:36563560-36563582 TTCCCAAGAGCCGGGTGCGGTGG - Intergenic
989571617 5:42951181-42951203 TTACCGGGCGGCGGCGGCGCTGG - Intergenic
990265915 5:54075562-54075584 AACCCAGGAGGCGGAGGAGGTGG - Intronic
990639906 5:57771095-57771117 AACCCAGGAGGCGGAGGTGGCGG - Intergenic
990664264 5:58053936-58053958 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
990683263 5:58269977-58269999 GTCCCAGGAGGCTGAGGCAGGGG - Intergenic
994770905 5:103980738-103980760 TACCCAGGTGGCTGAGGCGGGGG + Intergenic
994921761 5:106054470-106054492 TACTCAGGAGGCTGAGGCGGAGG - Intergenic
995141519 5:108740705-108740727 AACCCAGGAGGCGGAGGCAGAGG - Intergenic
995454778 5:112339641-112339663 TACTCAGGAGGCTGAGGCGGGGG - Intronic
995527291 5:113060230-113060252 AACCCAGGAGGCGGAGGCTGTGG - Intronic
995569611 5:113466044-113466066 TACCCAGGAGGCTGAGGCAGGGG - Intronic
995821308 5:116236424-116236446 ATCCCAGGAGGCGGAGGTTGCGG + Intronic
996290995 5:121852112-121852134 GTCCCGGGAGGAGGCGGCTGCGG - Exonic
997536475 5:134626187-134626209 TACCCAGGAGGCTGAGGCAGGGG + Intronic
997754492 5:136383450-136383472 TACTCAGGAGGCTGAGGCGGGGG - Intronic
997984580 5:138492288-138492310 TGCCAAGGAGGGGGCGGCAGCGG + Intergenic
999293194 5:150441055-150441077 TACTCAGGAGGCTGAGGCGGAGG + Intergenic
999305808 5:150518884-150518906 TACCCAGGAGGCTGAGGCAGGGG - Intronic
999693172 5:154166299-154166321 TTCCCCAGAGGCCGGGGCGGGGG + Intronic
999875985 5:155806230-155806252 AACCCAGGAGGCGGAGGTGGCGG - Intergenic
1000302891 5:159972054-159972076 CGCCCAGGCGACGGCGGCGGCGG - Exonic
1000319025 5:160119159-160119181 TCCCCCGGCGGCGGCGGTGGCGG + Exonic
1001124932 5:169010823-169010845 AACCCAGGAGGCGGAGGCAGAGG + Intronic
1002001060 5:176196491-176196513 TTCCTGGGAGGTGGGGGCGGGGG - Intergenic
1002029304 5:176416300-176416322 TGCCCCGGAGGCGGCGGAGGAGG - Exonic
1002046453 5:176543991-176544013 CGCCCAGGAGGCGGGGACGGTGG - Intronic
1002057396 5:176606304-176606326 CTCCCAGGAGGGGGCAGGGGAGG + Intronic
1002219945 5:177672212-177672234 TTCTGAGGTGGCGGCGGCGGGGG + Intergenic
1002253275 5:177942481-177942503 TTCCTGGGAGGTGGGGGCGGGGG + Intergenic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002666774 5:180831186-180831208 CCCCGAGGCGGCGGCGGCGGCGG - Intergenic
1002897961 6:1390054-1390076 CTCCGGGGCGGCGGCGGCGGCGG - Exonic
1003134920 6:3427641-3427663 TTCCCAGGATGCTGCTGAGGAGG - Intronic
1003265879 6:4564802-4564824 TTCCCTGGAGGCAGGGGCTGAGG + Intergenic
1003645532 6:7910644-7910666 GGCCCAGGAGGCGGCGGCGGCGG - Exonic
1003685481 6:8298119-8298141 AACCCAGGAGGCGGGGGCTGCGG - Intergenic
1004395532 6:15244697-15244719 TTCTCAGGAGGCAGCCGCCGGGG + Intergenic
1005040344 6:21595189-21595211 ATCCTGGCAGGCGGCGGCGGCGG + Exonic
1005040346 6:21595192-21595214 CTGGCAGGCGGCGGCGGCGGCGG + Exonic
1005040381 6:21595334-21595356 TGCCGAGGAGGCGGAGGCCGAGG - Exonic
1005044367 6:21628080-21628102 TACCCAGGAGGCGGAGGTTGCGG + Intergenic
1005319160 6:24635212-24635234 TACTCAGGAGGCTGAGGCGGAGG - Intronic
1006187237 6:32188466-32188488 CTCCCAGGAGGAGGAGCCGGTGG - Exonic
1006224229 6:32522479-32522501 CTCCCAGGAGGAGGCGGCGCGGG - Intronic
1006230823 6:32584681-32584703 CTCCCAGGAGGAGGCGGCGCGGG - Intronic
1006336906 6:33425714-33425736 TTCCTGGGAGGAGGCGGAGGGGG + Intronic
1006519660 6:34563968-34563990 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1006725493 6:36196784-36196806 TCCCCCGGGAGCGGCGGCGGCGG + Exonic
1006773508 6:36573767-36573789 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
1006792248 6:36710694-36710716 ATCCCAGGAGGCGGAGGTTGCGG - Intronic
1006950800 6:37819861-37819883 CTCTGAGGAGGCGGTGGCGGCGG - Exonic
1007358323 6:41336524-41336546 TTCCCAGGAGACTGGGGCGTGGG - Intronic
1007417633 6:41701283-41701305 TGCCCAGGAGGCGGGTGCAGGGG - Intronic
1007902217 6:45422741-45422763 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1008013380 6:46491416-46491438 GTCCCGGGTGACGGCGGCGGAGG - Intronic
1008911235 6:56735934-56735956 AGCCCAGGAGGCAGAGGCGGAGG - Intronic
1009435581 6:63614605-63614627 AACCCAGGAGGCGGAGGTGGTGG - Intergenic
1010195572 6:73236564-73236586 ATCCCAGGAGGTGGAGGTGGAGG - Intronic
1011286077 6:85724704-85724726 TACCCAGGAGGCTGAGGCAGGGG - Intergenic
1011307805 6:85947913-85947935 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012399996 6:98835069-98835091 TCCCACGGCGGCGGCGGCGGGGG + Exonic
1012475778 6:99613752-99613774 AGGCCAGGCGGCGGCGGCGGCGG - Exonic
1012715713 6:102666681-102666703 GTCCCAGGAGGCTGAGGTGGGGG + Intergenic
1013223230 6:108098660-108098682 AACCCAGGAGGCGGAGGTGGAGG + Intronic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1014183583 6:118409768-118409790 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1015124119 6:129733508-129733530 TTCCCAGGTGGTGGCAGCAGTGG - Intergenic
1015148924 6:130018505-130018527 CTCCCCGGCAGCGGCGGCGGCGG + Exonic
1015149264 6:130019968-130019990 GTGTCGGGAGGCGGCGGCGGCGG + Intronic
1015904881 6:138107087-138107109 CTTCCTGGAGGCGGCGACGGCGG + Intronic
1015921417 6:138269727-138269749 AACCCAGGAGGCGGAGGTGGCGG + Intronic
1015958109 6:138619226-138619248 TTCTCAGGAGGCTGAGGCAGGGG + Intronic
1016018093 6:139206588-139206610 AACCCAGGAGGCAGAGGCGGAGG + Intergenic
1016960295 6:149666538-149666560 AACCCGGGAGGCGGTGGCGGAGG + Intronic
1017130315 6:151102981-151103003 TTCTCAGGAGGCTGAGGTGGGGG - Intergenic
1017192224 6:151666727-151666749 TTCCCTGGAGGAGGAGGAGGAGG - Intronic
1017672243 6:156778735-156778757 GGCCCCGGCGGCGGCGGCGGAGG - Exonic
1017672318 6:156778974-156778996 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1017672415 6:156779291-156779313 GTCCCAGGCGGCGGCGGCGGGGG + Exonic
1018400492 6:163415139-163415161 CTCTCCGGCGGCGGCGGCGGCGG + Exonic
1018960950 6:168448299-168448321 CTCCCAGGAGGCTGGGGAGGAGG + Intronic
1019530144 7:1499213-1499235 GTCCCAGTTGGGGGCGGCGGGGG - Intronic
1019562635 7:1666082-1666104 TTCCCCGAGCGCGGCGGCGGCGG - Intergenic
1019614071 7:1950981-1951003 TTCCTGGGAGGAGGAGGCGGGGG + Intronic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1020033994 7:4952767-4952789 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1020204545 7:6104906-6104928 TGACCCGGAGGCGGCGGCGGCGG + Exonic
1020952827 7:14702565-14702587 TCCCCAGGAGGCTGTGGAGGAGG + Intronic
1021510279 7:21427158-21427180 AGCCGAGGAGGCGGCGGCAGAGG + Intergenic
1021827915 7:24573270-24573292 CGCCCAAGCGGCGGCGGCGGCGG + Intronic
1022012799 7:26323545-26323567 CACCCAGGAGGCGGCAGGGGTGG + Intronic
1022106156 7:27199454-27199476 GTCCGCGAAGGCGGCGGCGGCGG + Exonic
1023062040 7:36337018-36337040 AACCCAGGAGGCGGAGGTGGTGG + Intronic
1023078590 7:36506836-36506858 TACCCAGGAGGCTGAGGCTGAGG - Intergenic
1023947869 7:44817861-44817883 ATCCCAGGAGGCGGAGGTTGCGG + Intronic
1023955597 7:44884720-44884742 GGCCCGGGAGGCGGCGCCGGGGG - Exonic
1025255237 7:57380267-57380289 AACCCAGGAGGCGGAGGCGGAGG + Intergenic
1025615708 7:63114424-63114446 TGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1025806525 7:64838577-64838599 TTCCCGAGAGGAGGCGGCTGAGG - Intergenic
1025867695 7:65401964-65401986 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1026972966 7:74479168-74479190 ATCCCAGGAAGCTACGGCGGAGG - Intronic
1027008786 7:74723506-74723528 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1027137495 7:75635498-75635520 AACCCAGGAGGCGGAGGCGGTGG + Intronic
1027222200 7:76221133-76221155 TACCCAGGAGGCGGAGGTTGCGG - Intronic
1027374540 7:77537198-77537220 TCCTGAGGCGGCGGCGGCGGCGG + Intergenic
1028477058 7:91264704-91264726 TTCCGCGGCGGCGGCGGCTGCGG + Exonic
1028621487 7:92833567-92833589 TCCTCCGGCGGCGGCGGCGGCGG - Exonic
1028796519 7:94908658-94908680 ACCCAAGGAGGCGGGGGCGGGGG - Intronic
1029238748 7:99143847-99143869 TAACCTTGAGGCGGCGGCGGCGG - Exonic
1029315060 7:99704398-99704420 TACCCAGGAGGCTGAGGCAGGGG - Intronic
1029557346 7:101279533-101279555 AACCCAGGAGGCAGAGGCGGAGG + Intergenic
1029590190 7:101502230-101502252 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1029640257 7:101815901-101815923 GTCCTCGGTGGCGGCGGCGGCGG + Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1031361984 7:120857973-120857995 TTCCCAGGAGGCGGCGACGGCGG - Exonic
1032001329 7:128267408-128267430 TTCCCAGGGGATGGGGGCGGGGG + Intergenic
1032174358 7:129611696-129611718 CTCCTCGGCGGCGGCGGCGGCGG + Exonic
1032193974 7:129779516-129779538 TTCCCGGGCGGGGGCGGGGGCGG - Intergenic
1033288003 7:140059015-140059037 AACCCAGGAGGCGGAGGCCGTGG + Intronic
1033654351 7:143362780-143362802 GAGCCAGGCGGCGGCGGCGGCGG - Intergenic
1033899299 7:146116203-146116225 CTCACAGGAGCTGGCGGCGGCGG + Intergenic
1034147258 7:148884214-148884236 AGCCCCGGCGGCGGCGGCGGCGG - Exonic
1034173142 7:149078604-149078626 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1034177243 7:149109984-149110006 TACTCAGGAGGCGGAGGCAGGGG - Intronic
1034483531 7:151341705-151341727 TTTCCAAGCGGCGGCGGCGGCGG + Exonic
1034494187 7:151410224-151410246 GACCCAGGCGGCGGCGGCGGAGG - Intronic
1034598528 7:152223714-152223736 AACCCAGGAGGCGGAGGTGGAGG + Intronic
1035263136 7:157674291-157674313 TCCCCAGGAGGCGAGGGTGGGGG + Intronic
1035581042 8:738997-739019 TTCACCGGCGGCGGCGGCGGCGG - Intergenic
1035779433 8:2216271-2216293 TTCCCAGGAGGTGGCCTGGGTGG - Intergenic
1035879039 8:3223789-3223811 TTCCCAGGAGGATACGGCTGTGG + Exonic
1036518420 8:9467927-9467949 AACCCAGGAGGCGGAGGCTGTGG + Intergenic
1036523512 8:9514284-9514306 TTACAAGGAGGCTGCTGCGGTGG + Intergenic
1036771017 8:11578535-11578557 TTCCCAGGGTGGGGTGGCGGTGG - Intergenic
1036789503 8:11708674-11708696 TTCCCGGGCCGCGGCAGCGGCGG - Exonic
1037554193 8:20006136-20006158 TACTCAGGAGGCTGAGGCGGAGG + Intergenic
1037769081 8:21788518-21788540 TTCCCAGGAGGGGCCTGGGGAGG + Exonic
1037791841 8:21951016-21951038 TACCCAAGAGGCGGAGGCTGGGG + Intronic
1038001501 8:23395781-23395803 TACTCAGGAGGCTGAGGCGGAGG - Intronic
1038173150 8:25156904-25156926 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
1038196503 8:25373075-25373097 ATCCCAGGAGGCGGAGGTTGCGG - Intronic
1038465060 8:27754572-27754594 AGCCCAGGAGGCGGAGGCTGAGG - Intronic
1038575640 8:28701609-28701631 TTTCGCGCAGGCGGCGGCGGCGG + Exonic
1038575641 8:28701612-28701634 CGCGCAGGCGGCGGCGGCGGCGG + Exonic
1038752343 8:30307205-30307227 ATCCCAGGAGGCGGAGGTTGCGG - Intergenic
1039235912 8:35502666-35502688 TACTCAGGAGGCGGAGGCAGGGG - Intronic
1039322108 8:36443660-36443682 TACCCAGGAGGCTGAGGTGGGGG - Intergenic
1039454608 8:37698430-37698452 ATGGCAGGAGGCGGCGGCGGCGG - Exonic
1039586769 8:38713567-38713589 TGTCCAGGAGGCGGCTGGGGAGG - Intergenic
1039884409 8:41646982-41647004 TTCCCAGGTGGAGGAGGAGGAGG - Intronic
1040065593 8:43141296-43141318 CTCCCAGGCGGCGGCGGCGGCGG - Intronic
1040080345 8:43277284-43277306 CTCCCAGGTGGCGGCGCCGAGGG - Intergenic
1041088594 8:54280806-54280828 AACCCAGGAGGCGGAGGCTGTGG - Intergenic
1041101795 8:54403434-54403456 ATCCCAGGAGGCAGAGGCTGTGG + Intergenic
1041271978 8:56117848-56117870 TAGCCAGGAGGCGGCGAGGGCGG - Intergenic
1041919799 8:63168832-63168854 GGCCCAGGCAGCGGCGGCGGCGG + Exonic
1042051328 8:64711400-64711422 TTCCCAGGAAGCAGCGGTGGTGG - Intronic
1042374704 8:68036860-68036882 TTTCCAGGAGGCGGAGGTTGTGG + Intronic
1042893258 8:73636265-73636287 TACTCAGGAGGCGGAGGTGGGGG + Intronic
1042962870 8:74321501-74321523 GGCCCAGGCGGCGGCGGCGAAGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043436703 8:80242058-80242080 TACTCAGGAGGCGGAGGCAGGGG - Intergenic
1043464034 8:80487183-80487205 TTCCGAGGCGGCGGCGGCGGGGG + Exonic
1043502958 8:80874325-80874347 CTCCCGGGCGGCGGCGGCGGCGG - Intronic
1043841283 8:85107292-85107314 TGCTATGGAGGCGGCGGCGGCGG + Exonic
1044573266 8:93742709-93742731 TACTCAGGAGGCGGAGGCAGAGG + Intergenic
1044699048 8:94949653-94949675 TTTCCAGGAGCCGGCGGGAGCGG + Intronic
1044821881 8:96160713-96160735 TCCCCAGGAGGCGGTGGCGGCGG + Exonic
1045166763 8:99615037-99615059 AACCCAGGAGGCGGAGGCTGCGG + Intronic
1045315238 8:101038418-101038440 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1045453044 8:102347720-102347742 TACGCAGGAGGCAGAGGCGGAGG - Intronic
1045516299 8:102863630-102863652 GCCCCCGGCGGCGGCGGCGGCGG - Intronic
1045582982 8:103499968-103499990 GACCCAAGGGGCGGCGGCGGTGG + Intergenic
1046547433 8:115669111-115669133 GTCCCGGCGGGCGGCGGCGGCGG - Intronic
1046657052 8:116906367-116906389 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1046659965 8:116938477-116938499 CGTGCAGGAGGCGGCGGCGGCGG + Exonic
1046912660 8:119646044-119646066 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1047124349 8:121943885-121943907 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
1047499415 8:125430287-125430309 TCACCAGGAGGCGGAGGAGGTGG + Intergenic
1047537342 8:125731953-125731975 TTCCCTGGAGACGGAGACGGGGG + Intergenic
1048214266 8:132480869-132480891 CTCCGGGGCGGCGGCGGCGGCGG + Exonic
1049109851 8:140635786-140635808 GTCCGCGGCGGCGGCGGCGGCGG + Intergenic
1049402865 8:142438147-142438169 TCCCCTGGATGCGGGGGCGGGGG - Intergenic
1049614646 8:143570837-143570859 TTACCAGGGGGTGGGGGCGGGGG - Intronic
1049628719 8:143639299-143639321 AACCCAGGAGGCGGAGGTGGAGG - Intronic
1049662162 8:143824351-143824373 GTCCGAGCCGGCGGCGGCGGCGG - Exonic
1049788439 8:144462375-144462397 GGCCGAGGCGGCGGCGGCGGCGG - Intronic
1049851083 8:144830809-144830831 AACCCAGGAGGCGGAGGTGGCGG - Intronic
1050415995 9:5418520-5418542 TCCCCAGGGGGTGGCGGAGGAGG - Intronic
1050562021 9:6843941-6843963 TACTCAGGAGGCGGCTGAGGAGG - Intronic
1051248487 9:15135952-15135974 AACCCGGGAGGCGGAGGCGGAGG - Intergenic
1051936379 9:22447253-22447275 TCCCGAGGTGGCGGCAGCGGCGG - Exonic
1052362160 9:27573217-27573239 CTTCCCGGCGGCGGCGGCGGCGG - Intronic
1052953765 9:34235936-34235958 AACCCAGGAGGTGGAGGCGGAGG - Intronic
1053018267 9:34676412-34676434 TTCTCAGGAGGCTGAGGTGGAGG + Intergenic
1053050617 9:34958244-34958266 GGCTGAGGAGGCGGCGGCGGCGG - Intronic
1053114612 9:35490125-35490147 TTCCGCGCCGGCGGCGGCGGCGG - Intronic
1053358979 9:37469447-37469469 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
1055091113 9:72365279-72365301 AACCCCGGCGGCGGCGGCGGCGG + Intergenic
1055266309 9:74498812-74498834 GTCGCAGGCGGTGGCGGCGGCGG + Intronic
1055611781 9:78031593-78031615 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
1056440662 9:86617848-86617870 TACTCAGGAGGCTGAGGCGGGGG + Intergenic
1057182751 9:93038716-93038738 TACTCAGGAGGCTGAGGCGGAGG - Intergenic
1057244166 9:93440170-93440192 AACCCAGGAGGCGGAGGCGGAGG + Intergenic
1057245480 9:93451529-93451551 GCTCCCGGAGGCGGCGGCGGAGG - Intronic
1057352188 9:94308224-94308246 AACCCAGGAGGCGGAGGCTGCGG + Intergenic
1057655454 9:96947866-96947888 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1057800572 9:98188684-98188706 AACCCAGGAGGCAGAGGCGGAGG + Intronic
1058421220 9:104835168-104835190 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1058467566 9:105244661-105244683 TCCCCCGGCGGCGGCGACGGCGG - Exonic
1058589521 9:106547682-106547704 AACCCAGGAGGCGGAGGTGGCGG + Intergenic
1058637973 9:107055308-107055330 TTCTCAGGAGGCTGAGGCAGGGG + Intergenic
1058885717 9:109320300-109320322 CGCCGAGGAGGAGGCGGCGGCGG + Exonic
1059102395 9:111483511-111483533 ATCCTGGGAGGCGGAGGCGGCGG + Intronic
1059332027 9:113541681-113541703 TTCCAAGGAGGAGGAGGAGGAGG + Intronic
1059432403 9:114258085-114258107 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1059448461 9:114354950-114354972 AACCCAGGAGGCGGAGGCAGAGG - Intronic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1059484568 9:114616941-114616963 TTCCCAGGAGGAGAAGGAGGAGG - Intronic
1059769823 9:117414765-117414787 CTCCCGCGAGGCAGCGGCGGTGG + Exonic
1059849998 9:118327241-118327263 ATCCCAGGAGGCGGAGGTTGCGG + Intergenic
1060224441 9:121782635-121782657 TGTCCAGGAGGCGGCCGCAGAGG + Intronic
1060468707 9:123930056-123930078 ACCCCTGGAGGCGGCGGCGGCGG - Exonic
1060864451 9:126984211-126984233 TTCTCAGGAGGCTGAGGCAGAGG - Intronic
1061033408 9:128100328-128100350 CTCCTGGGAGGCGGGGGCGGGGG + Intronic
1061060500 9:128247876-128247898 CTCCCTGGTGGTGGCGGCGGTGG + Intronic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061153240 9:128841423-128841445 AACCCAGGAGGCGGAGGCGGAGG + Intronic
1061162694 9:128904438-128904460 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1061374936 9:130218699-130218721 TTCTCAGGAGGCTGAGGCAGGGG - Intronic
1061440356 9:130598916-130598938 TACCCAGGAGGCTGAGGTGGTGG + Intronic
1061485234 9:130917249-130917271 TGCCCAAGAGGCTGCGGCTGCGG - Intronic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1061545626 9:131302553-131302575 TTCCCAGGAGGTGGCTGGGGAGG - Intronic
1061641149 9:131957362-131957384 TACTCAGGAGGCTGAGGCGGAGG - Intronic
1061824752 9:133251218-133251240 TTCTCAGAAGGCGGCGGGGTGGG + Intronic
1062305010 9:135900830-135900852 AACCCAGGAGGCGGAGGCTGCGG - Intronic
1062403717 9:136383636-136383658 GTCTCCGGAGGCGGCGGCGGAGG - Exonic
1062551140 9:137087120-137087142 TCCCGATGAGGCGGCGGCGGCGG - Exonic
1062661101 9:137633921-137633943 TTCTCAGGAGGCTGAGGCAGGGG - Intronic
1062661483 9:137637251-137637273 AACCCAGGAGGCGGAGGCTGTGG - Intronic
1203771682 EBV:52916-52938 GTCCCAGTAGGAGTCGGCGGCGG + Intergenic
1185505466 X:630128-630150 TTGGGAGGCGGCGGCGGCGGAGG - Intronic
1185728852 X:2445045-2445067 TACTCAGGAGGCTGAGGCGGGGG + Intronic
1185775167 X:2797303-2797325 CTAACAGGAGGTGGCGGCGGTGG + Exonic
1185877049 X:3710479-3710501 TTCTCAGGAGGCTGAGGCAGAGG - Intronic
1185959520 X:4533699-4533721 AACCCAGGAGGCAGAGGCGGAGG - Intergenic
1186077931 X:5900681-5900703 TTCTCAGGAGGCTGAGGCAGAGG - Intronic
1187067461 X:15854718-15854740 TTGGCCGGCGGCGGCGGCGGCGG + Exonic
1187226075 X:17376084-17376106 GTCCTCGGCGGCGGCGGCGGCGG + Exonic
1187281592 X:17861414-17861436 ACCCGAGGAGGCGGCGGCGGAGG + Intergenic
1187405570 X:19000810-19000832 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1187507203 X:19887445-19887467 TTCCTCAGTGGCGGCGGCGGCGG + Exonic
1187831664 X:23388719-23388741 TACCCAGGAGGCTGAGGCAGGGG + Intronic
1188005489 X:25013524-25013546 GTCCCAGGCCGCGGCGGCCGCGG + Exonic
1188250870 X:27892553-27892575 TACCCAGGAGGCTGAGGCAGGGG + Intergenic
1188887132 X:35564655-35564677 AACCCAGGAGGCGGAGGCTGCGG - Intergenic
1189251196 X:39601710-39601732 TTGCCAGCAGGCGGGGGCTGGGG - Intergenic
1189407115 X:40735354-40735376 CCGCCCGGAGGCGGCGGCGGGGG - Exonic
1189867469 X:45346141-45346163 TCCCCAGGAGGCAGCTGAGGTGG - Intergenic
1189986135 X:46554839-46554861 TACTCAGGAGGCTGAGGCGGAGG + Intergenic
1190119798 X:47650513-47650535 TTCCGAGGCGGCGGTGGAGGTGG + Exonic
1190285376 X:48957720-48957742 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1190385437 X:49879337-49879359 TTCACTGAAGGAGGCGGCGGCGG - Intergenic
1190474401 X:50813131-50813153 AACCCTGGCGGCGGCGGCGGCGG + Intronic
1190713058 X:53083052-53083074 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1191126218 X:56957041-56957063 TTCTCAGGAGGCTGAGGCAGGGG + Intergenic
1191129786 X:56995458-56995480 CTTCCTGGTGGCGGCGGCGGTGG + Exonic
1192093383 X:68184442-68184464 AACCCAGGAGGCGGAGGCTGTGG + Intronic
1192988659 X:76427957-76427979 TTGCAACGCGGCGGCGGCGGCGG - Exonic
1193923925 X:87463143-87463165 TTCTCAGGAGGCTGGGGCTGTGG - Intergenic
1194356031 X:92885063-92885085 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
1194464312 X:94213556-94213578 ATCCCAGGAGGCGGAGGTTGCGG - Intergenic
1194846360 X:98814326-98814348 TACCCAGGAGGCTGAGGGGGAGG - Intergenic
1194977595 X:100409722-100409744 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
1195100980 X:101553360-101553382 TGCCCAGGAGGCAGGGGTGGAGG + Exonic
1195951907 X:110284046-110284068 AACCCAGGAGGCGGCGGTTGCGG + Intronic
1196684187 X:118496329-118496351 TGCGGAGGAGGCGGAGGCGGAGG + Intronic
1196786852 X:119428343-119428365 TACTCAGGAGGCTGAGGCGGAGG + Intronic
1196828490 X:119758804-119758826 CTCCCGGGAGGCGGCGGCTGCGG - Exonic
1197799202 X:130331624-130331646 AACCCAGGAGGCGGAGGCTGAGG - Intergenic
1198767092 X:140091337-140091359 GACCGAGGCGGCGGCGGCGGCGG + Intergenic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1199699257 X:150364069-150364091 TTCCCAGGAGTTGGCAGGGGAGG - Intronic
1200231022 X:154443978-154444000 TCCACAGGAGCCGGCGGCGGGGG + Intergenic
1200664377 Y:6002041-6002063 TACTCAGGAGGCTGAGGCGGGGG - Intergenic
1200761691 Y:7044721-7044743 ACCCCAGGAGGCGGAGGCTGTGG - Intronic
1200788223 Y:7277028-7277050 TTCTCAGGAGGCTGAGGCAGAGG + Intergenic