ID: 979354021

View in Genome Browser
Species Human (GRCh38)
Location 4:119681251-119681273
Sequence CAATTTAATCACACTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979354021_979354026 3 Left 979354021 4:119681251-119681273 CCTCTTAGAGTGTGATTAAATTG No data
Right 979354026 4:119681277-119681299 GTTAAGGGACGGGTCGAATTAGG No data
979354021_979354025 -7 Left 979354021 4:119681251-119681273 CCTCTTAGAGTGTGATTAAATTG No data
Right 979354025 4:119681267-119681289 TAAATTGATAGTTAAGGGACGGG No data
979354021_979354027 18 Left 979354021 4:119681251-119681273 CCTCTTAGAGTGTGATTAAATTG No data
Right 979354027 4:119681292-119681314 GAATTAGGTAAATGAAACATAGG No data
979354021_979354028 19 Left 979354021 4:119681251-119681273 CCTCTTAGAGTGTGATTAAATTG No data
Right 979354028 4:119681293-119681315 AATTAGGTAAATGAAACATAGGG No data
979354021_979354024 -8 Left 979354021 4:119681251-119681273 CCTCTTAGAGTGTGATTAAATTG No data
Right 979354024 4:119681266-119681288 TTAAATTGATAGTTAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979354021 Original CRISPR CAATTTAATCACACTCTAAG AGG (reversed) Intergenic
No off target data available for this crispr