ID: 979356207

View in Genome Browser
Species Human (GRCh38)
Location 4:119708741-119708763
Sequence CCTGCTCCTTCAGTGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979356204_979356207 29 Left 979356204 4:119708689-119708711 CCAAAAATGTTTTTTTTTAATTC No data
Right 979356207 4:119708741-119708763 CCTGCTCCTTCAGTGATCCCTGG No data
979356205_979356207 3 Left 979356205 4:119708715-119708737 CCAGCAAACTAATGTTTGTCAGT No data
Right 979356207 4:119708741-119708763 CCTGCTCCTTCAGTGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979356207 Original CRISPR CCTGCTCCTTCAGTGATCCC TGG Intergenic
No off target data available for this crispr