ID: 979356542

View in Genome Browser
Species Human (GRCh38)
Location 4:119712408-119712430
Sequence GCCCCACACACAGTTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979356535_979356542 19 Left 979356535 4:119712366-119712388 CCCTCATGGAGGGCAGTGTGAAA No data
Right 979356542 4:119712408-119712430 GCCCCACACACAGTTCCCCCTGG No data
979356536_979356542 18 Left 979356536 4:119712367-119712389 CCTCATGGAGGGCAGTGTGAAAG No data
Right 979356542 4:119712408-119712430 GCCCCACACACAGTTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979356542 Original CRISPR GCCCCACACACAGTTCCCCC TGG Intergenic
No off target data available for this crispr