ID: 979357415

View in Genome Browser
Species Human (GRCh38)
Location 4:119721406-119721428
Sequence CTAGCTACACACACATACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979357414_979357415 14 Left 979357414 4:119721369-119721391 CCTATCAATCAATGAGTGGATAA 0: 512
1: 987
2: 1283
3: 1524
4: 7016
Right 979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG No data
979357412_979357415 26 Left 979357412 4:119721357-119721379 CCAGCTGAAATGCCTATCAATCA No data
Right 979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979357415 Original CRISPR CTAGCTACACACACATACCA TGG Intergenic
No off target data available for this crispr