ID: 979357415 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:119721406-119721428 |
| Sequence | CTAGCTACACACACATACCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 979357414_979357415 | 14 | Left | 979357414 | 4:119721369-119721391 | CCTATCAATCAATGAGTGGATAA | 0: 512 1: 987 2: 1283 3: 1524 4: 7016 |
||
| Right | 979357415 | 4:119721406-119721428 | CTAGCTACACACACATACCATGG | No data | ||||
| 979357412_979357415 | 26 | Left | 979357412 | 4:119721357-119721379 | CCAGCTGAAATGCCTATCAATCA | No data | ||
| Right | 979357415 | 4:119721406-119721428 | CTAGCTACACACACATACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 979357415 | Original CRISPR | CTAGCTACACACACATACCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||