ID: 979359081

View in Genome Browser
Species Human (GRCh38)
Location 4:119740683-119740705
Sequence CCTAGCACTTGGAGGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979359081_979359088 4 Left 979359081 4:119740683-119740705 CCTCACCCCCTCCAAGTGCTAGG No data
Right 979359088 4:119740710-119740732 TACGTGTGAGCTACCACACTCGG No data
979359081_979359091 24 Left 979359081 4:119740683-119740705 CCTCACCCCCTCCAAGTGCTAGG No data
Right 979359091 4:119740730-119740752 CGGCAGAAGATGGATTTGAGAGG No data
979359081_979359089 14 Left 979359081 4:119740683-119740705 CCTCACCCCCTCCAAGTGCTAGG No data
Right 979359089 4:119740720-119740742 CTACCACACTCGGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979359081 Original CRISPR CCTAGCACTTGGAGGGGGTG AGG (reversed) Intergenic
No off target data available for this crispr