ID: 979363629

View in Genome Browser
Species Human (GRCh38)
Location 4:119794340-119794362
Sequence AGTTCAGGCAGATGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979363624_979363629 11 Left 979363624 4:119794306-119794328 CCAGAAATTAAAACACGAGATGT No data
Right 979363629 4:119794340-119794362 AGTTCAGGCAGATGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979363629 Original CRISPR AGTTCAGGCAGATGTCATGG AGG Intergenic
No off target data available for this crispr