ID: 979383672

View in Genome Browser
Species Human (GRCh38)
Location 4:120038298-120038320
Sequence TAGCAGAAGCACCATCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979383668_979383672 13 Left 979383668 4:120038262-120038284 CCATGGAGACCCATAAAGTTCTT No data
Right 979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG No data
979383669_979383672 4 Left 979383669 4:120038271-120038293 CCCATAAAGTTCTTGAGAATTTT No data
Right 979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG No data
979383670_979383672 3 Left 979383670 4:120038272-120038294 CCATAAAGTTCTTGAGAATTTTA No data
Right 979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979383672 Original CRISPR TAGCAGAAGCACCATCAGGT TGG Intergenic
No off target data available for this crispr