ID: 979392513

View in Genome Browser
Species Human (GRCh38)
Location 4:120143277-120143299
Sequence TTGGAAGCACAGATAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979392513_979392515 8 Left 979392513 4:120143277-120143299 CCAAGCTTTATCTGTGCTTCCAA No data
Right 979392515 4:120143308-120143330 TAAAATTGCCTATAATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979392513 Original CRISPR TTGGAAGCACAGATAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr