ID: 979403317

View in Genome Browser
Species Human (GRCh38)
Location 4:120277954-120277976
Sequence GCATTAACAGGGCTTTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979403317_979403323 4 Left 979403317 4:120277954-120277976 CCCTAACAAAGCCCTGTTAATGC No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403317_979403324 5 Left 979403317 4:120277954-120277976 CCCTAACAAAGCCCTGTTAATGC No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979403317 Original CRISPR GCATTAACAGGGCTTTGTTA GGG (reversed) Intergenic