ID: 979403323

View in Genome Browser
Species Human (GRCh38)
Location 4:120277981-120278003
Sequence ATTACAGTTCCAAATAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979403316_979403323 20 Left 979403316 4:120277938-120277960 CCTGGAGTATCTAAAGCCCTAAC No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403315_979403323 29 Left 979403315 4:120277929-120277951 CCATTTATTCCTGGAGTATCTAA No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403317_979403323 4 Left 979403317 4:120277954-120277976 CCCTAACAAAGCCCTGTTAATGC No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403319_979403323 -7 Left 979403319 4:120277965-120277987 CCCTGTTAATGCCCATATTACAG No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403318_979403323 3 Left 979403318 4:120277955-120277977 CCTAACAAAGCCCTGTTAATGCC No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data
979403320_979403323 -8 Left 979403320 4:120277966-120277988 CCTGTTAATGCCCATATTACAGT No data
Right 979403323 4:120277981-120278003 ATTACAGTTCCAAATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979403323 Original CRISPR ATTACAGTTCCAAATAGAAT TGG Intergenic