ID: 979403324

View in Genome Browser
Species Human (GRCh38)
Location 4:120277982-120278004
Sequence TTACAGTTCCAAATAGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979403316_979403324 21 Left 979403316 4:120277938-120277960 CCTGGAGTATCTAAAGCCCTAAC No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data
979403319_979403324 -6 Left 979403319 4:120277965-120277987 CCCTGTTAATGCCCATATTACAG No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data
979403320_979403324 -7 Left 979403320 4:120277966-120277988 CCTGTTAATGCCCATATTACAGT No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data
979403315_979403324 30 Left 979403315 4:120277929-120277951 CCATTTATTCCTGGAGTATCTAA No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data
979403318_979403324 4 Left 979403318 4:120277955-120277977 CCTAACAAAGCCCTGTTAATGCC No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data
979403317_979403324 5 Left 979403317 4:120277954-120277976 CCCTAACAAAGCCCTGTTAATGC No data
Right 979403324 4:120277982-120278004 TTACAGTTCCAAATAGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979403324 Original CRISPR TTACAGTTCCAAATAGAATT GGG Intergenic