ID: 979403361

View in Genome Browser
Species Human (GRCh38)
Location 4:120278898-120278920
Sequence GTATCTAAAAAGTTGAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979403361_979403363 24 Left 979403361 4:120278898-120278920 CCTTATCTCAACTTTTTAGATAC No data
Right 979403363 4:120278945-120278967 AGAAACTTTTTCTTTAGTGATGG No data
979403361_979403364 27 Left 979403361 4:120278898-120278920 CCTTATCTCAACTTTTTAGATAC No data
Right 979403364 4:120278948-120278970 AACTTTTTCTTTAGTGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979403361 Original CRISPR GTATCTAAAAAGTTGAGATA AGG (reversed) Intergenic
No off target data available for this crispr