ID: 979405014

View in Genome Browser
Species Human (GRCh38)
Location 4:120299168-120299190
Sequence AAGAAAAAGGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979405014_979405018 19 Left 979405014 4:120299168-120299190 CCTTCCTCTTTCTCCTTTTTCTT No data
Right 979405018 4:120299210-120299232 TATTTTATAGATGAGGAAACTGG 0: 8
1: 108
2: 606
3: 1772
4: 3865
979405014_979405017 12 Left 979405014 4:120299168-120299190 CCTTCCTCTTTCTCCTTTTTCTT No data
Right 979405017 4:120299203-120299225 TCATCTTTATTTTATAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979405014 Original CRISPR AAGAAAAAGGAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr