ID: 979411219

View in Genome Browser
Species Human (GRCh38)
Location 4:120382532-120382554
Sequence CTATATATTCACATGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979411219_979411222 -10 Left 979411219 4:120382532-120382554 CCGTGCTCCATGTGAATATATAG No data
Right 979411222 4:120382545-120382567 GAATATATAGGAATTTGCCAAGG No data
979411219_979411224 11 Left 979411219 4:120382532-120382554 CCGTGCTCCATGTGAATATATAG No data
Right 979411224 4:120382566-120382588 GGATGATTTTCAAAATATTCAGG No data
979411219_979411225 24 Left 979411219 4:120382532-120382554 CCGTGCTCCATGTGAATATATAG No data
Right 979411225 4:120382579-120382601 AATATTCAGGCCAGATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979411219 Original CRISPR CTATATATTCACATGGAGCA CGG (reversed) Intergenic
No off target data available for this crispr