ID: 979418636

View in Genome Browser
Species Human (GRCh38)
Location 4:120475888-120475910
Sequence CCTTCTATATAGAAGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979418636_979418640 2 Left 979418636 4:120475888-120475910 CCAACATCCTTCTATATAGAAGG No data
Right 979418640 4:120475913-120475935 AAAAGGCATCTCTAATTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979418636 Original CRISPR CCTTCTATATAGAAGGATGT TGG (reversed) Intergenic
No off target data available for this crispr