ID: 979423857

View in Genome Browser
Species Human (GRCh38)
Location 4:120540163-120540185
Sequence CAAAATGCTTATAGTCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979423857_979423859 -2 Left 979423857 4:120540163-120540185 CCAACATGACTATAAGCATTTTG No data
Right 979423859 4:120540184-120540206 TGGATTCCCTCCAGCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979423857 Original CRISPR CAAAATGCTTATAGTCATGT TGG (reversed) Intergenic
No off target data available for this crispr