ID: 979425317

View in Genome Browser
Species Human (GRCh38)
Location 4:120557242-120557264
Sequence CTGAAAATTCAGATGTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979425317_979425318 -1 Left 979425317 4:120557242-120557264 CCATTGCACATCTGAATTTTCAG No data
Right 979425318 4:120557264-120557286 GCATCTCTACTCTTACATATTGG No data
979425317_979425320 30 Left 979425317 4:120557242-120557264 CCATTGCACATCTGAATTTTCAG No data
Right 979425320 4:120557295-120557317 TTGAACAAACACTGTTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979425317 Original CRISPR CTGAAAATTCAGATGTGCAA TGG (reversed) Intergenic
No off target data available for this crispr