ID: 979426051

View in Genome Browser
Species Human (GRCh38)
Location 4:120568680-120568702
Sequence AAAGGGCTGTTGATCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979426051_979426053 -9 Left 979426051 4:120568680-120568702 CCACCAGAGATCAACAGCCCTTT No data
Right 979426053 4:120568694-120568716 CAGCCCTTTATTACATACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979426051 Original CRISPR AAAGGGCTGTTGATCTCTGG TGG (reversed) Intergenic
No off target data available for this crispr